1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dalvyx [7]
3 years ago
14

Which period is older than the Triassic period?

Biology
2 answers:
bearhunter [10]3 years ago
8 0

Explanation:

The Triassic is the oldest period in the Mesozoic Era. But the Permian Period came before.

artcher [175]3 years ago
8 0

Answer:

Cretaceous

Explanation:

In the time span of the Mesozoic era the Jurassic came after the Cretaceous.

You might be interested in
What are two main drawbacks of nuclear power?​
alexandr1967 [171]
Environmental impact and radioactive waste
3 0
3 years ago
At the beginning of cellular respiration, energy is stored in the bonds of
kap26 [50]
At the end of cellular respiration must be right
7 0
4 years ago
Calculate the potential energy of a 25kg boulders at the ledge of a 150m high
Crank

Answer:

36750J

Explanation:

Potential energy, which is the energy of a body at rest or in a position is calculated as follows;

P.E = m × g × h

Where;

m = mass (kg)

g = acceleration due to gravity = 9.8m/s²

h = height of the boulder (m)

According to the provided information;

m = 25kg, h = 150m

Using P.E = m.g.h

P.E = 25 × 9.8 × 150

P.E = 36750 Joules

7 0
3 years ago
Steps in protein synthesis Step order : initiation complex formed with addition of large ribosomal subunit translocation small r
Alina [70]

Answer:

1. transcription of mRNA from DNA

2. small ribosomal subunit binds to mRNA

3.initiation complex formed with addition of large ribosomal subunit

4.codon recognition (non-initiating site)

5.peptide bond formation

6.translocation

7. ribosome reads a stop codon

8.polypeptide chain is released from the P site

9. ribosomal subunits dissociate

Explanation:

The translation is a process which translates the nitrogenous bases or codons in the proteins.

The process of translation requires the mRNA, tRNA and ribosome and proceeds in three stages: the initiation, elongation and the termination.

The process begins with the binding of the small subunit of the ribosome to the mRNA. The charged tRNA with a first amino acid called methionine binds the mRNA and scans the mRNA until it finds the start codon.  

After it finds the start codon, the large subunit complex binds the mRNA and form initiation complex. After this, the amino acid enters the P-site of the ribosome where elongation of peptide takes place.

The peptide then exits from the E-site and the ribosome dissociates.

7 0
3 years ago
Which of the following attributes of oxygenated blood makes functional MRI (fMRI) possible? A. It can be seen using x-rays. B. A
Oksi-84 [34.3K]
<h2>Answer is option "B"</h2>

Explanation:

  • Our brain requires an enormous measure of vitality and so as to meet this needs the progression of blood must be accurately arranged to guarantee that oxygen is being conveyed where it is required and when it is required.  
  • Vitality in the mind is created solely from a type of digestion that requires oxygen. However, neurons just keep up a little save of vitality and these cells require a constant inventory of oxygen, particularly when the cells are terminating and speaking with their neighbors.  
  • Blood dashing through a brain district's trap of vessels is an indication that nerve cells in that region have kicked vigorously. The blood races to dynamic territories to supply terminating neurons with the oxygen and glucose they require for vitality.  
  • Hence, the correct answer is option B "Active areas of the brain take up more oxygenated blood than they need for their energy requirements"

6 0
3 years ago
Other questions:
  • I put all the points i had in this s please help
    12·1 answer
  • Kesav used to grow pea plant in his field after the harvesting of paddy. What do you think the advantage of this type of croppin
    6·1 answer
  • A galaxy that has a shape similar to a football is a(n) ____ galaxy. a. normal spiral c. elliptical b. barred spiral d. irregula
    11·2 answers
  • Fossils provide clear evidence that evolution has occurred.<br> True<br> False
    5·1 answer
  • Which term indicates the style of reasoning that uses data to form a conclusion?
    11·1 answer
  • 1.John has very good body co-ordination to become a free style dancer. Which system is involved in carrying out such co-ordinati
    15·1 answer
  • Explain differences between exponential growth and logistic growth.
    14·2 answers
  • What is predation? Explain
    13·2 answers
  • Cyclostomata are fish made of
    12·2 answers
  • transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!