1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frozen [14]
3 years ago
12

HELP ME PLEASE! List the steps scientists for using technology to find the half-life of an isotope.​

Biology
1 answer:
liubo4ka [24]3 years ago
6 0

For radioactive materials with short half-lives, you use a very sensitive calibrated detector to measure how many counts per second it is producing. Then using the exact same set up you do the same at a latter time. You use the two readings and the time between them to determine the half-life. You don’t have to wait exactly a half-life, you can do the math with any significant time difference. Also, you don’t need to know the absolute radioactivity, as long as the set up is the same you only need to know fraction by which it changed.

For radioactive materials with long half-lives that won’t work. Instead you approach the problem differently. You precisely measure the mass of a very pure sample of the radioactive material. You can use that to calculate the number of atoms in the sample. Then you put the sample in a counter that is calibrated to determine the absolute number of disintegrations happening in a given time. Now you know how many of them are disintegrating every second. You use the following equations:

Decays per Second = (Number of Atoms) x (Decay Constant)

Half-life = (Natural Log of 2) / (Decay Constant)

And you can calculate the half-life

Hope it helps :)

Mark it as brainliest pls :)

You might be interested in
The reproductive system in both males and females are controlled and regulated by the interaction of hormones from the hypothala
Kazeer [188]

Answer:

it's 26 and female and write the value

5 0
2 years ago
1. Explain how parents and offsprings can become different from eachother.
Fudgin [204]

Answer:

In asexual reproduction all the genes in the offspring come from one parent. In sexual reproduction one full set of the genes come from each parent. Living things produce offspring of the same species, but in many cases offspring are not identical with each other or with their parents.

Explanation:

5 0
3 years ago
Kinetic energy is the energy of what?
ad-work [718]

Answer:

It’s the energy something holds while or due to the motion

Explanation:

6 0
3 years ago
Read 2 more answers
Which choice forms the organic portion of soil?
irina1246 [14]

Answer: The dead plants form the organic part of the soil.  This is because when plants die off they become dirt and mulch which is good for the plants. This is why people make a big deal out of compost. It is because it is healthy and organic for plants.

7 0
3 years ago
Read 2 more answers
I absolutely need help now! is it possible for populations to be affected by weather? Give Examples
lbvjy [14]
Yes of course!
In the most catastrophic case, it can kill hundreds of thousands through hurricanes and the things that come with hurricanes. 
Droughts can cause death by both dehydration and starvation if the rain is the only dependable source of arrogation 
Too much rain causes floods which can be fatal too
3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the difference between cell differentiation and cell specialization
    8·1 answer
  • _____ are (is) to cells what organs are to humans
    6·1 answer
  • A forest was cleared to build a road. Which two would be the most likely effects on the ecosystem?
    9·2 answers
  • A family takes its summer vacation at a beach resort. Six-year-old Timmy spends the entire morning in a swimming pool. When his
    6·1 answer
  • By what mechanism does refrigeration at 4°c slow food spoilage by contaminating microbes?
    11·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Question
    7·1 answer
  • Environmental factors carn have various effects on ecosystems. In August 2005, Hurricane Katrina caused signifcant damage in sev
    10·2 answers
  • Which organelle triggers the destruction of skin cells responsible for the webbing of skin between the fingers and toes of a dev
    13·1 answer
  • PLEASE HELP I WILL GIBE BRAINALIST
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!