1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nutka1998 [239]
4 years ago
13

What do cellular respiration and fermentation have in common? They both occur in the mitochondria, they both Harvest energy from

sugars, they both require oxygen to occur, they both end up with pyruvic acid.
Biology
2 answers:
vlabodo [156]4 years ago
7 0

Answer:

They both harvest energy from sugars.

Explanation:

Cellular respiration and fermentation are reactions of the energy metabolism of organisms, which aims to obtain energy for metabolic reactions from the breakdown of glucose (sugar) in ATP. ATP keeps in its phosphate bonds energy that will be used in metabolism. This nucleotide is the energy currency of the cell.

Slav-nsk [51]4 years ago
5 0

Answer:

Fermentation and cellular respiration are alike in that they both begin with a series or reactions known as glycolysis, which breaks glucose molecules into smaller pyruvate molecules. They are also similar in that during both processes ATP is produced for the cell to use.

Hope it helps.

You might be interested in
How is the FOG produced?
gayaneshka [121]
Fog begins to form when water vapor condenses into tiny liquid water droplets that are suspended in the air.
3 0
3 years ago
Read 2 more answers
Given the cascade of events leading to ischemia-produced brain damage, it has been suggested that __________ antagonists adminis
Trava [24]

Answer: glutamate

Explanation: Given the cascade of events leading to ischemia-produced brain damage, it has been suggested that glutamate antagonists administered immediately after a stroke might reduce the subsequent development of brain damage.

5 0
2 years ago
I need help please and thank you
Natalka [10]

Answer:

Option A

Explanation:

Prokaryotic cells do not have specialized tasks because they are mostly unicellular (in rare cases multicellular) and don't have a nucleus.

3 0
3 years ago
Why is the cell cycle important to human bodies
zhuklara [117]
You need it in order to be living
4 0
3 years ago
Read 2 more answers
As they change to another substance over time,<br> elements give off energy.
aniked [119]

Answer:

Yes, this is true.

Explanation:

Don't really have an explaination sry.

P.S. Please give Brainliest :)

8 0
3 years ago
Other questions:
  • Molecule that contains the information for the growth and functioning of the cell
    14·1 answer
  • What do geological principles tell you about inclusions?
    12·2 answers
  • As opposed to external fertilization, internal fertilization ensures that
    15·1 answer
  • А<br> В<br> С<br> H<br> G<br> E<br> E<br> Which organelle is labeled A
    11·1 answer
  • Identify the most likely cause of the following scenario:
    7·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Which is a TRUE statement about the energy pyramid shown?
    7·1 answer
  • You have a growth on your back. Your sibling describes it as being an icky totally purple
    6·1 answer
  • Why rapidly digestible starch good for weak person and slowly digestible starch is good for diabetic person
    9·1 answer
  • During photosynthesis, the energy used to pump protons comes from ___________, whereas in cellular respiration it comes from ___
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!