1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashcka [7]
3 years ago
8

Explain why or why not ethics belong in science.

Biology
1 answer:
WARRIOR [948]3 years ago
8 0

Answer:

Ethics can be described as some rules which help humans to differentiate the right and wrong. Ethics in science teach us to remain honest in all scientific practices. The methods and process used should be ethical.

Without ethics, science would be a disaster. Scientists would have easily marketed the clones of humans in the market making science miserable. Without ethics, scientists might have killed a wide number of organisms just to gain results for their experiments.

Hence, ethics and science go hand in hand for making this field a valuable aspect for humans.

You might be interested in
What are the products of photosynthesis ?
Zepler [3.9K]

Answer:

The main product of photosynthesis is glucose

Hope that helped and also I will change my profile to have something different than the sonic movie because ugh it's weird

6 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Investigator Sheer is testifying about DNA evidence she found at the crime scene that matches the suspect on trial. The prosecut
Ratling [72]
She will give the DNA fingerprinting report to the jury which will have samples of suspect and its profile matching to the evidence found at the scene of crime.


In DNA fingerprinting hair, blood, semen, or other biological samples are required for the comparison of suspect and evidence. It depends on the unique polymorphism in their DNA.
The fragments of DNA are made to run on the electrophoresis gel and the similar bands observed will confirm the matching.
The DNA fingerprinting will provide very exact evidence if the DNA samples matched.
5 0
2 years ago
If carbon dioxide is completely removed from a plants environment , what would you expect to happen to the plants production of
Zigmanuir [339]
The plant's production of high-energy sugars would reduce significantly. I'm not going to say that the plant would completely stop producing the sugars because it has to respire, and one product of respiration would be carbon dioxide. This carbon dioxide would be recycled so that the plant can photosynthesize and produce sugars.
3 0
2 years ago
Read 2 more answers
The nurse manager of a surgical unit observes a nurse providing colostomy care to a client without using any personal protective
vlada-n [284]
The appropriate response of the nurse manager is to reprimand the nurse providing the colostomy care to a client without PPE because of the risk of transmitting nosocomial infections and maintaining hospital hygiene. The use of personal protective equipment should always be imposed in doing potentially infectious work, especially in the hospital.
8 0
3 years ago
Other questions:
  • Describe two examples of steroids and their physiological function.
    7·1 answer
  • What Are the Differences Between Eukaryotic and Prokaryotic Cells? <br><br> Written response
    7·2 answers
  • What relationship exists between nutrients and biomolecules?
    5·2 answers
  • Which statement best describes the similarity between the recessive allele and the dominant allele?
    6·1 answer
  • Is most of the tubule filtrate reabsorbed into the body or excreted in urine explain?
    10·1 answer
  • Why do birds have hallow bones?
    9·1 answer
  • If blonde hair is dominant and designated as "b" and brunette hair is recessive and designated as "b," probability would predict
    9·1 answer
  • Help me plssss thanksssssssssssss.
    13·2 answers
  • In the 1960's, deaths from lung cancer skyrocketed. Doctors treating these patients
    15·1 answer
  • .................................
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!