1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
____ [38]
3 years ago
10

If you put in 12 molecules of water in photosynthesis and in the end you only get 6 molecules of water, do you lose water in pla

nts?
Biology
1 answer:
DochEvi [55]3 years ago
3 0

the water evaporated

You might be interested in
Students were given a list of seven elements and asked to identify the four elements that are most abundant in biomolecules. Whi
velikii [3]

Answer:

A is the correct answer bud

4 0
3 years ago
In most organisms, the end product of glycolysis is pyruvate. Pyruvate still contains a substantial amount of energy, which can
RSB [31]

Answer:

Pyruvate helps in the production of ATP.

Explanation:

The molecule of pyruvate converted into acetyl CoA. Then each molecule which is produced during glycolysis loses electron and carbondioxide releases. After the breakdown of pyruvate, the electrons loses by pyruvate are transferred to NAD+ in order to produce NADH, which will be used by the cell to produce energy molecule such as ATP. So we can say that pyruvate plays a vital role in the formation of ATP molecule.

8 0
2 years ago
Which of these are examples of your first line of defense?
aalyn [17]
A. hope this helps :)
3 0
3 years ago
Read 2 more answers
One advantage of having a cloned flock
Cerrena [4.2K]
It eliminates certain genetic diseases or bad traits for the flock.
4 0
3 years ago
Read 2 more answers
Help if i fail i will not pass
Vinil7 [7]

Answer:

3

Explanation:

I hope this is correct and have a great day

5 0
2 years ago
Read 2 more answers
Other questions:
  • What membrane in a diarthrotic joint provides lubrication for movement?
    13·1 answer
  • Structures that have different functions in different species but develop from the same embryonic tissues are called ___________
    5·2 answers
  • Enzymes can be affected by acidity and alkalinity. What name is given to the scale that measures acidity and alkalinity?​
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Most of the chemosensory neurons arising in the nasal cavity have axonal projections that terminate in the
    12·1 answer
  • The offspring of the cross-fertilization of pea plants with purple flowers and pea plants with white flowers are called Question
    13·1 answer
  • What type of traits do autosomes determine
    7·2 answers
  • How does compaction lead to lithification
    13·1 answer
  • Which of the following are part of the 10 essentials list
    7·1 answer
  • Which feature is characteristic of viruses​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!