1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
statuscvo [17]
3 years ago
8

A leaf preserved in hard transparent material is found in:

Biology
2 answers:
Artyom0805 [142]3 years ago
8 0
The answer is Fossilized Amber.
soldier1979 [14.2K]3 years ago
3 0

Answer: Fossilized Amber.

Explanation:

Amber is a Fossilized tree resins which has a distinctive color and beauty and has been in existence since the Neolithic time and it well appreciated by people.

It is formed when plants or animals died in a water environment and it is buried in mud and silt.

You might be interested in
What can be concluded from the graph? A) The decay in the population is not linear. B) The diseased population increases with ti
puteri [66]

Answer:

it is (A)

Explanation:

i did this like a mouth ago

6 0
3 years ago
The ability of your body's immune system to distinguish between your cells
KatRina [158]

Answer:

<em>The correct option is cell surface markers.</em>

Explanation:

The immune cells of our body detect foreign particles and generate responses so that our body can get rid of them. The foreign particles are often termed as antigens.

The immune cells such as antibodies possess cell surface receptors which detect the foreign objects or antigens. When the cell surface receptors detect any antigen they immediately recognize that a foreign particle has invaded the body and they then identify it and start to generate response.

6 0
3 years ago
A Ferrel so moved between
Arte-miy333 [17]

do you have a graph or an image you can attach

7 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Answers to definition
AlladinOne [14]

Answer:

Explanation:

Species: a group of living organisms consisting of similar individuals capable of exchanging genes or interbreeding.

Population: a particular group or type of people or animals living in a place.

Gene pool: the stock of different genes in an interbreeding population.

Mutations: the changing of the structure of a gene, resulting in a variant form that may be transmitted to subsequent generations, caused by the alteration of single base units in DNA, or the deletion, insertion, or rearrangement of larger sections of genes or chromosomes.

Lateral Gene Transfer: the movement of genetic material between unicellular and/or multicellular organisms other than by the transmission of DNA from parent to offspring (reproduction).

Single-gene Traits: when a trait is linked to one gene-pair that consists of two alleles.

Polygenic Traits: is one whose phenotype is influenced by more than one gene.

3 0
3 years ago
Other questions:
  • How does the wind-driven process of deflation alter the surface
    12·1 answer
  • Which of the following methods of agriculture is the most reliant upon technology and automation
    12·1 answer
  • Lipids are all _____________ , which means that they won’t dissolve in water.
    10·2 answers
  • In a force of 12 N is applied to an object with a mass of 2 kg what will be its acceleration
    10·2 answers
  • In a classic experiment using pea shape
    8·1 answer
  • Is a person's weight determined by genes, the environment or a combination of both?
    11·2 answers
  • The hypothalamus, which is involved in maintaining steadiness of bodily functions, the hippocampus, which is involved in memory,
    10·1 answer
  • Farmer Fran sprays her sugarcane field with a highly effective pesticide called 'Bayou Bug Blast'. For five years the pesticide
    8·2 answers
  • Why was Fisher skeptical of Mendel's data?
    8·1 answer
  • What is the maximum number of amino acids that could be coded for by a
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!