1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrew [12]
3 years ago
8

Identify four changes that a stream undergoes before it reaches the ocean?

Geography
2 answers:
UNO [17]3 years ago
8 0

Before the stream reaches the ocean, the changes it undergoes are:

  1. The stream becomes deeper because it makes its way through different regions.
  2. The amount of water that the stream carries increases as it meanders through different parts and encounters rainfall and melting snow.
  3. The stream becomes wider at places where it covers more area. The stream generally becomes narrow or wide depending on the region it passes through.
  4. The velocity with which the stream flows decreases as the amount of water in the stream increases.    
Yanka [14]3 years ago
6 0

1 - The flow of the river may change as water is fed out into tributaries. 2- As a river flows it may etch out the river bed and create a gulley as it moves sediment and debris. 3- Depending on the speed of a stream it can form into a meandering river with twists and turns. What is interesting about these rivers is they actually move as debris is deposited on one side of the meander and picked up on the other. 4 - Depending on topography the river may increase in speed and give you rapids.

You might be interested in
Which hypothesis mentioned in the book proposes that equatorial regions are poor because tropical diseases have consequences for
Firdavs [7]

Answer:

The answer is the Geography Hypothesis.

Explanation:

The geography hypothesis holds that the differences in prosperity that are found around the world are due in large part to forces of nature, like the differences in geography, climate, and ecology that are evident in different regions of the world. The geography hypothesis emphasizes how the natural environment can explain why some nations are more prosperous than others. In contrast, the institutions hypothesis emphasizes the influences that are made and caused by humans. Human poverty is largely man-made in the institutions view.  

5 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
2) Identify two purposes that maps serve.
kenny6666 [7]
A map serves two purposes: It is a tool for storing reference material and a tool for communicat- ing geographic information. route between two places and to avoid getting lost along the way.
4 0
3 years ago
The essential element of geography called “physical systems” focuses on the study of __________.
skad [1K]
I think it should be B.
5 0
3 years ago
Read 2 more answers
What was significant about the election of Olusegun Obasanjo to the Nigerian presidency in 1999?
erik [133]

The Presidential election in Nigeria in 1999 was significant because it is the first election after the 1993 coup and it is the first election of the Nigerian republic. In this election, Olusegun Obasanjo won over Olu Falae. 62.78% of votes was casted under Obasanjo.

3 0
3 years ago
Other questions:
  • Which of the following is not a likely result of an increase in a country’s immigration
    10·1 answer
  • The principle of Uniformitarianism states that:
    7·1 answer
  • About 85% of people who live in Africa live __________.
    8·2 answers
  • Do constructive waves have a strong swash and a weak backwash???
    12·1 answer
  • Whats a promblem that prevents africa from being able to fully utilize is resources
    13·1 answer
  • Which of the timelines above correctly shows the order of historical events on the African continent?
    9·2 answers
  • B.
    12·2 answers
  • A) In which direction does ITCZ shift in winter?
    6·1 answer
  • How and why is Northern Europe so different from Southern Europe? In your answers, make sure to use examples of climate, culture
    11·1 answer
  • Which of the following statements CANNOT be attributed to the spread of modern agriculture?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!