1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KiRa [710]
3 years ago
6

Which statement is true regarding cystic fibrosis? It is autosomal-dominant. It affects endocrine glands. It is common in Africa

n Americans. It is the most common genetic disease in the United States.
Biology
1 answer:
stepan [7]3 years ago
4 0

Answer:

The correct answer is - It is the most common genetic disease in the United States.

Explanation:

Cystic fibrosis is the genetic disease that affects the several body system and organ such as lungs and digestive system. This hereditary disease is autosomal recessive.

It is not common in ethnic populations such as African Americans and Asian Americans while in white population of US it is a very common genetic disease as it occurs in one individual in every 2500 to 3500 white infants.

Thus, the correct answer is - It is the most common genetic disease in the United States.

You might be interested in
(100 Points + Brainlest)
Olin [163]

Answer:

they are all things related to decomposed corpse remains or like remains in a animal.

Explanation:

5 0
3 years ago
Read 2 more answers
Any gene that can turn a normal cell into a tumorous cell is called an
Molodets [167]

It would be an oncogene, these can be inherited mutations of proto-oncogenes that cause the oncogene.

4 0
3 years ago
Which of the following is not a difference between Prokaryotic cells?
lawyer [7]

Answer:

The age of the cell

Explanation:

Assuming your question was meant to be "Which of the following is NOT a difference between Prokaryotic and Eukaryotic cells?", everything except the age is different.

Prokaryotes are simple cells that have no nucleus and are generally small. Eukaryotes are complex cells that have a nucleus, organelles, and are much bigger than prokaryotes.

8 0
2 years ago
Consider the diagram. mc002-1.jpg Which process is represented? nondisjunction translocation inversion insertion
sladkih [1.3K]

If this is the picture you are talking about, the right answer is non-disjunction

Non-disjunction is the non-separation of homologous chromosomes at the time of cell division which results in the formation of ova or spermatozoa leading to an abnormality in the number of chromosomes of the egg thus fertilized by the spermatozoa.

The fertilized egg consists of either a single chromosome, what is called monosomy, or, conversely, three chromosomes, this is called trisomy. While naturally, the fertilized egg has a single pair of chromosomes.

7 0
3 years ago
Read 2 more answers
Humans have what type of circulatory system
Goryan [66]
The cardiovascular system I think. Hope this helps
4 0
3 years ago
Read 2 more answers
Other questions:
  • Gregor mendel concluyo que cada guisante tiene dos unidades para cada rasgo y cada gameto cotiene una unidad . Las unidades de m
    8·1 answer
  • The fossil record resembles the living species in the same geographic area. how does this pattern support the theory of evolutio
    13·1 answer
  • What is the control variable in the experiment
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • When researchers are measuring plant productivity, they usually harvest and measure above-ground biomass. But with grassland pla
    9·1 answer
  • Select all that apply. Which of the following are not properties of lipids? derived from fish, beans, milk, and eggs made up of
    15·1 answer
  • What are Krebs cycle inputs and outputs?
    5·1 answer
  • Which of the following components is NOT needed to create small organic molecules?
    13·1 answer
  • The key difference between fats and
    7·1 answer
  • Think about how acids and bases would affect the water quality in the two lakes. which set of ph data would you expect to see ba
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!