1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elanso [62]
3 years ago
14

Which receptors adapt most slowly?

Biology
1 answer:
svlad2 [7]3 years ago
5 0
2) nociceptors
Hope this helps.

You might be interested in
If an isotope of oxygen has one less neutrons how many electrons does it have​
MA_775_DIABLO [31]

It has one less electrons then protons

6 0
3 years ago
Which of the following is a characteristic of the tidal region of an ocean
Lubov Fominskaja [6]
The defining characteristic of the intertidal zone is that it is submerged with water during high tide and exposed to the air during low tide. The zone can take many forms, from sandy beaches to rocky cliffs. It is common for the intertidal zone to change frequently, since it is constantly battered by crashing waves.
Hope this helped.
5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The rate at which blood flows through the human body changes in response to many factors. Which statement describes one of these
Oksana_A [137]

Answer:

Im waiting on an answer aswell.

Explanation:

3 0
3 years ago
How are insects classified on the basis of eating
7nadin3 [17]
It's important to prepare the insects properly before eating: Wash the insects. Boil, steam or fry them for at least five minutes. Eat the prepared insects directly after cooking.
4 0
3 years ago
Other questions:
  • Explain how some heterotrophs could be described as either a primary consumer or a secondary consumer.
    14·1 answer
  • Hemoglobin, a protein, is built by...?
    15·1 answer
  • Sperm cells are found inside pollen. What kind of cells are sperm?
    5·1 answer
  • An elongating ribosome is bound to appropriate tRNAs in both the A and P sites and is ready for peptidyl transfer. What happens
    14·1 answer
  • A man has an air conditioner he wants to load into the back of his truck. Instead of lifting the air conditioner and carrying it
    13·2 answers
  • Heterotrophic bacteria create their own food ?
    5·1 answer
  • The accuumulation of sediment found along a lake or a ocean
    6·1 answer
  • What is the genotype of blood group B
    13·1 answer
  • A wildlife biologist does a DNA gel to determine how closely related four species of trout are to one another. These are the res
    13·2 answers
  • This membrane allows blank to pass through
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!