1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wariber [46]
2 years ago
15

"Some people are tempted to say that the more genes an organism has, the more advanced it is. Discuss this idea: what kinds of a

rguments support it and what arguments refute it.
Biology
1 answer:
stepan [7]2 years ago
4 0

Answer:

The number of genes partially explains how an organism has evolved and how it gained complexity.

Explanation:

The number of genes of a bacteria versus an eucaryotic organism is quite distinct and so is their complexity. A prokaryotic organism like a bacteria has a set of genes necessary to exert their basic functions and the number of genes compared to a eucaryotic cell is 3-30 times smaller, which defines a direct correlation of number of genes and complexity. However if we consider only eucaryote organisms and their complexity there is no such direct correlation between number of genes and their complexity when, for example, we compare the number of genes of humans (approximately 18000) and the number of genes of the <em>Trichomonas vaginalis, </em>an anaerobic, flagellated protozoan parasite and the causative agent of trichomoniasis. The number of genes of <em>T. vaginalis</em> is far bigger than the human cell, however the human complexity is far more advanced than the parasite organism.

You might be interested in
True or false? when describing a net force, you need to know the size and direction of the force
VladimirAG [237]

Answer:

yes you do because you will need to know how big and how much force it can be put into

Explanation:

5 0
2 years ago
What is the symbol for carbohydrates
Mariana [72]
The answer is none. carbon has a symbol (c) but there is no symbol for carbohydrates because its not a chemical compound.for example fats or vitamins or minerals
8 0
3 years ago
Any one free?For talk any indian gìrl​
kykrilka [37]

Answer:

no pe i aint indian

Explanation:

8 0
2 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
2 years ago
Read 2 more answers
Which of the following is NOT true of
stich3 [128]

They aren't all the same is not true of evolutionary trees.

<h3>What are evolutionary trees?</h3>

Evolutionary trees are trees that help to arrange and reconstruct the evolutionary history of species or groups of organisms belonging to either genera, families, or orders. The trees reconstruct and show case two form of information that is related to evolutionary change, cladogenesis and anagenesis.

Therefore, They aren't all the same is not true of evolutionary trees.

Learn more about evolutionary tress here.

brainly.com/question/2189834

6 0
1 year ago
Other questions:
  • What bones make the palm of the hand​
    6·1 answer
  • Which type of organism contains a cell wall and how does this structure benefit that organism?
    5·2 answers
  • You get violently ill one hour after eating a meal. what possible form of food intoxication might you have contracted?
    15·1 answer
  • ¿El alcohol es una droga?Razona tu respuesta
    7·1 answer
  • The process that occurs when memories that are temporarily stored in the hippocampus migrate for storage elsewhere in the brain
    6·1 answer
  • The order is divided into two categories: prosimians and anthropoids.
    7·1 answer
  • Crospiere
    11·1 answer
  • when cells need energy to do work certain enzymes release the energy stored in the chemical bonds of​
    13·1 answer
  • HELP PAST DUE AND NO WEBISTES/ FAKE LINKS
    6·1 answer
  • A nucleotide consists of?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!