1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tju [1.3M]
3 years ago
6

What are some important questions to ask when evaluating scientific conclusions?

Biology
2 answers:
Valentin [98]3 years ago
7 0

Answer:

The question should be asked would be-

can the data be repeated?

does the conclusion make sense?

are there another possible conclusion.

Explanation:

The reviewers or the evaluating team of scientists asses the data and experiment and explain if the experiment is valid or not. It is assessed by the peer reviewers of the particular experiment.

One can evaluate a scientific conclusion by raising a few questions like; if the presented data can be repeated or not. If the conclusion makes sense or not on the basis of the published or presented data. The possible question could be if the presented experiment and data can be explained by another conclusion.

Thus, the question should be asked are-  

can the data be repeated?

does the conclusion make sense?

are there another possible conclusion.

forsale [732]3 years ago
4 0
Some of the important questions to be asked should be: Is the procedure of obtaining the results accurate? If not, by how much is its reliability? Are the results useful for further scientific research? What can you recommend to others who might want to make the same scientific conclusions?

You might be interested in
What is a community of organisms that live in a particular area, along with non living things?
sergiy2304 [10]

i thinks its an ecosystem

5 0
3 years ago
_________________________are organisms that produce their own organic molecules for energy and nutrition using energy from light
Free_Kalibri [48]
Its autotrophs, they are the first level of the food pyrimid

4 0
3 years ago
Which organism impacts their environment the most?
Vlad [161]

Explanation:

What environment is it?

4 0
3 years ago
Nitrogen cycle and algal bloom
salantis [7]
What is the question?
6 0
2 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • A professor is teaching a class anatomy and physiology and mentions that closure of the airway occurs at anatomically different
    5·1 answer
  • Humans can cool down by perspiring, which removes heat from the body by evaporation. However, dogs are not able to perspire, so
    14·1 answer
  • What pigment found in skin originates from outside the body?
    6·2 answers
  • 1. DNA strand 1: TCT- TTA- CAT<br> - DNA STRAND 2: <br> - mRNA: <br> amino acid sequence:<br> tRNA:
    14·2 answers
  • This organelle removes and recycles waste from the cell
    5·2 answers
  • If a red blood cell has a diameter of 8 mm and a student shows it with a diameter of 40 mm in a drawing, what is the magnificati
    7·1 answer
  • Due today i have a C and need to bring my grade to a B and will mark brainliest
    7·1 answer
  • Que es la velocidad media<br><br>​
    11·1 answer
  • Pls help!!!<br><br> which one is the answer?
    10·1 answer
  • Help me check my answer! And rephrase if needed
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!