1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren2701 [21]
3 years ago
10

Describe at least one part of the experiment procedure you thought was essential for getting good results. Did you find that cer

tain steps in the procedure had to be followed carefully to get consistent results? If you wanted better results, do you think there is a step that could have been added to the procedure? Discuss your thoughts on the overall lab design. Did it help you understand the concepts better, or did it raise more questions? Do you think you could have designed a better experiment? If so, explain how and then discuss it with your classmates. Share some of your knowledge with them to learn a little more about this experiment.
Biology
1 answer:
atroni [7]3 years ago
3 0

Answer:

Control environment is the most important procedures for getting good results.

Explanation:

The control environment for an experiment is the essential part for getting good results. In control environment, there is no or less chances of infestation from the external environment which can cause the results of the data more acceptable. So the scientists prefers laboratory for performing experiment as compared to outer environment. So in my opinion for getting better results, the control environment is the most necessary experimental procedure.

Yes, for getting better results I think there is a step that could have been added to the procedure is to follow the international standard procedures for taking the readings by the experimenter.

You might be interested in
Suppose you crossed a heterozygous yellow pea plant (Yy) with a homozygous green pea plant (yy). What are the possible genotypes
NeTakaya
I love these!!!!!!!!!!!!!!!!!

ok so Yy,yy,Yy,yy the possible genotypes are Yy, and yy
the phenotypes are green and yellow 

:)
5 0
3 years ago
Which one of the following statements provides the best evidence that prokaryotic cells are less complex than eukaryotic cells?
Stolb23 [73]

Answer:

The answer is C

Explanation:

8 0
3 years ago
Ecologists in California are concerned about the effects of urbanization and the spread of invasive species on the biodiversity
Nesterboy [21]

Answer:

A,B,C,D

Explanation:

I got 100%

8 0
2 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
What type of forest would you find south of spruce?
iren2701 [21]
Oak, so the answer is A.
8 0
2 years ago
Other questions:
  • Which two extinction risks may be a direct result of the pet trade?
    8·1 answer
  • Which is not a process involved in the formation of sedimentary rocks
    12·1 answer
  • Based on the data, we determined that plant growth is affected by the type of soil What is the student doing ?
    8·1 answer
  • ______________is the passing of a wave through an object.
    10·2 answers
  • Which state of matter has a definite shape and definite volume
    8·2 answers
  • Where does the goldenrod plant originate from?
    10·1 answer
  • Energy is converted from glucose, in the presence of oxygen, into numerous ATP molecules during
    9·1 answer
  • Which is an example of artificial light?
    8·2 answers
  • Hemophilia is a sex linked recessive trait found on the X chromosome. A woman who is a carrier for hemophilia, but does not have
    13·1 answer
  • An athete who excels at short sprints most likely has more _____________ muscle fibers as compared to a marathoner.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!