1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
15

What 3 types of molecules are examples of signal molecules?

Biology
1 answer:
olasank [31]3 years ago
6 0
The majority of signal molecules are peptides and small proteins. Both are made of a chain of amino acids, the difference being the number of amino acids that make up the molecule. Generally, if the signal molecules has fewer than 50 amino acids it is considered  a peptide. If it has more it is considered a protein.
You might be interested in
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Fans attending university of florida athletic events are responsible for providing carbon offsets for _____.
kotegsom [21]

Answer:

any use of electricity in the stadium

Explanation:

7 0
2 years ago
DNA Polymerase is responsible for:
ZanzabumX [31]

Answer:

A

Explanation:

DNA polymerase is responsible for adding to the bases of the structure.

4 0
2 years ago
what is the study of the past and present geological distribution of species and the patterns that emerge from such analysis?​
Leokris [45]

Answer:

<u>B</u><u>i</u><u>o</u><u>g</u><u>e</u><u>o</u><u>g</u><u>r</u><u>a</u><u>p</u><u>h</u><u>y</u><u> </u>is the study of past and present ....

..... such analysis

Tq

Pls rate my ans

3 0
2 years ago
The amount of fuel used to heat and cool your home can be reduced by good ______.
DENIUS [597]
I believe the answer is Management, hope this helps :)
3 0
3 years ago
Read 2 more answers
Other questions:
  • Function of each plant structure
    8·1 answer
  • What are three characteristics of a sustainable ecosystem?
    11·1 answer
  • 1. The Himalayas in South Africa are an example of what type of plate boundary?
    5·2 answers
  • 1. Independent variable:
    14·1 answer
  • What is the main function of the Endoplasm Reticulum?
    12·2 answers
  • What is an allele?
    14·2 answers
  • Studies have been conducted on synthetic products
    14·1 answer
  • What would be the magnification of a specimen viewed with a compound light microscope that has an objective power of 10x and an
    14·2 answers
  • What are some of the results of too much sun exposure? What are some ways you can protect yourself from harmful sun exposure?
    8·2 answers
  • 10. If one strand of DNA is
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!