1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
15

What 3 types of molecules are examples of signal molecules?

Biology
1 answer:
olasank [31]3 years ago
6 0
The majority of signal molecules are peptides and small proteins. Both are made of a chain of amino acids, the difference being the number of amino acids that make up the molecule. Generally, if the signal molecules has fewer than 50 amino acids it is considered  a peptide. If it has more it is considered a protein.
You might be interested in
In respect to the foundations of prejudice social identity theory is associated with the concept of
den301095 [7]
Racism is one of the leading causes of social identity based on and associated with the foundations of prejudice.
5 0
3 years ago
Read 2 more answers
Carbon never quits. It recycles itself constantly, conserving its mass and energy as it travels from one location to another.
Andre45 [30]

Answer:

The answer is True.

Earth stores carbon naturally as part of the carbon cycle. When the system is not in equilibrium, it corrects itself. The Earth has been emitting and storing carbon for millions of years, cycling it between sky, sea, soil, and rock. And the law of conservation of matter states that no matter is destroyed, nor created, likewise with energy.

4 0
3 years ago
Develop a hypothesis regarding how using contaminated or purified water might affect plant biodiversity. which pot do you believ
Juli2301 [7.4K]
Contaminated water such as polluted water can sometimes cause an explosion of new plant growth by providing necessary nutrients and food and at other times it can kill or harm plants such as by raising or lowering acidity. Plants need at least good levels of potassium, nitrogen and phosphorus for healthy growth and by corollary, biodiversity. I believe that water which contains these elements, even if it be contaminated with the right contaminants will aid in biodiversity by enhancing growth. On the other hand, if there is too much salt, for example in the water it will prevent growth and inhibit photosynthesis.
8 0
3 years ago
This graph shows the variation in birth weights in a specific population of humans.
lorasvet [3.4K]

Answer:

There is a moderate variation in birth weight.

Explanation:

8 0
3 years ago
What is the element of lipid and protein
bagirrra123 [75]
I think the answer would be Nitrogen.
8 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • A human with the karyotype 49, xxxyy forms _______ barr bodies.
    5·1 answer
  • predict what biodiversity changes that would be expected to occur in response to changing environmental factors
    9·1 answer
  • The higher the elevation the slower the weathering will occur. True or False.
    14·1 answer
  • PERIOD
    6·1 answer
  • Im playing football and my head is starting to hurt is this a sign of a cuncussion
    12·2 answers
  • Whales communicate with other whales by making low-frequency sounds. They
    8·1 answer
  • Which wold tell you for sure if you had a sample of real gold​
    8·2 answers
  • How do selective pressures affect the genetic variation in the population
    6·1 answer
  • What methods are you using to test this (or each) hypothesis?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!