This is an example of CONDOMINANCY.
Condominancy is said to occur when two different alleles are combined together to form a different allele, in which the alleles are expressed equally and none of them is dominant. In the example given above, the black rat population mated with the white rat population to produce offspring that are grey in colour. Thus, the white and the black colour of the parents are not dominant, but are equally expressed to give gray colour.
The following are exclusively functions of the female reproductive system: nourishing a developing baby, protects the developing offspring, and serves as place where fertilization takes place.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
I think it is Top predator <span />
Cloning
This is the process of producing similar populations of genetically identical individuals.
