1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren [92.7K]
4 years ago
5

Researchers randomly divide participants into groups. Each group takes a different amount of omega-3 fatty acid supplements dail

y for a month. One group receives a placebo. The researchers measure the impact on cholesterol levels in the blood.
What is the purpose of random assignment in this experiment?

A, To produce treatment groups with similar characteristics
B, To ensure that all people with high cholesterol have an equal chance of being selected for the study
C, To increase the accuracy of the research results and prevent skewness in the data
Biology
1 answer:
zhenek [66]4 years ago
3 0

I think that the correct answer is C) To increase the accuracy of the research results and prevent skewness in the data. It is just a research which may lead to valuable information and perhaps another more relevant information.

You might be interested in
Climate warming trends allow plant and insect species to inhabit larger ranges.<br> true or false
Slav-nsk [51]
The answer to this question is true
5 0
3 years ago
Read 2 more answers
explain some of the interactions between air, land, water, and life that transfer energy in and around the globe and contribute
Sauron [17]

Answer:

              Air,water,land,these are the A-biotic factors of the environment and are associated with life in many ways and life is totally defendant on these A-biotic factors of the life

Explanation:

                     Life is basically dependent on two components the biotic (living things) and A-biotic (non living) components of life.Living component are inked to each other with food chain and the energy  is transferred between the food chains and the energy is made by the producer with the help of a biotic factors associated with the life. By using A-boitic component the producers the primary component of the food chain make the food and is consumed by the consumers and then the same way the energy is transferred  from on level to the next level and energy is consumed up to 10 percent  in each level of the food chain.

3 0
4 years ago
ANSWER FOR BRAINILEST
OLga [1]

Answer:

Ok I am so sorry if I get this wrong but from my understandings, Glucose and oxygen go in the Both slot. Then ATP and NADPH go in the Light dependent reactions. And Finally ADP and NADP go in the Light Independent reactions

Explanation:

I hope this helps you, but like I said I am sorry if I got some wrong.

8 0
3 years ago
If I have pericoronitis, than when should I get it checked out by a dentist??
Tju [1.3M]
Without any improvement within 5 days, usually after that you should make an appointment with your dentist.
4 0
3 years ago
Read 2 more answers
BIOLOGY
lubasha [3.4K]

Answer:

a similar function diff phylum

7 0
3 years ago
Other questions:
  • Transgenic bacteria are currently used to produce blank
    13·1 answer
  • Question 5 (True/False Worth 4 points) (05.01 LC) Individual cells do not need to maintain homeostasis. True False
    7·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which of the following statements is true regarding cerebral lateralization? Check all that apply
    12·1 answer
  • Two true-breeding pea plants are crossed, one with purple flowers and the other with white. their offspring are
    7·1 answer
  • 13. Air moving over the surface of the Earth:
    12·1 answer
  • Are there photosynthetic organisms that do not contain chlorophyll? If so, what are
    9·1 answer
  • The process of mitosis plays an important role in which of the following? Check all that apply.
    5·1 answer
  • Which is NOT an example of leaves humans commonly eat?
    5·1 answer
  • Why is determining the AVR important
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!