1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
levacccp [35]
3 years ago
10

Consider the following characteristics of the cells found in muscle tissue. Which feature is shared by both cardiac muscle and s

keletal muscle? Group of answer choices branched cells intercalated discs striations triads
Biology
1 answer:
AleksandrR [38]3 years ago
4 0

Answer:

striations

Explanation:

Cardiac muscles are present in the wall of the heart. These muscles have uninucleated, tubular and branched fibers. The fibers of cardiac muscles are striated and have the intercalated disc to spread the contraction quickly throughout the heart.  

Skeletal muscle fibers are tubular and multinucleated. These muscle fibers also have striations. Skeletal muscles are attached to the skeleton. Arrangement of actin and myosin in these muscle fibers given them the striated appearance.

You might be interested in
Which class of mollusks contain octopi and squids?<br> Anthozoa<br> Gastropoda<br> Cephalopoda
bija089 [108]

Answer:

Cephalopods

Explanation:

Cephalopods are a group of molluscs that include the pearly chambered Nautilus, squids, and the octopus. They can be divided into three categories: the Nautiloidea (chambered Nautilus), the Ammonoidea (the extinct ammonites), and the Dibranchiata (squids, the extinct belemnites, and octopuses).

8 0
2 years ago
If you want to selectively label RNA being synthesized by cells(and not DNA) what radioactive compound would you add to the medi
romanna [79]

The right answer is E.

Uracil is a nitrogenous base (pyrimidine) specific for RNA. The nucleoide of uracil is called uridine and nucleotide is called uridine monophosphate or uridylate. In the DNA, there is thymine instead of uracil.

So if we mark the uracils, only the RNA will be marked. The DNA will not be given that there is no uracil in it.

6 0
3 years ago
Process by which body (somatic) cells are produced.
Mice21 [21]

Process by which body (somatic) cells are produced is called Mitosis

7 0
4 years ago
(GIVING BRAINLIEST!!!)
joja [24]
D is the correct answer :).

The four inner planets have slower orbits, slower spin, no rings, and they are made of rock and metal. The four outer planets have faster orbits and spins, a composition of gases and liquids, numerous moons, and rings. The outer planets are made of hydrogen and helium, so they are called gas giants.
7 0
3 years ago
Read 2 more answers
Why do you think an animal cell does not have a chloroplast
Alina [70]
Chloroplasts are organelles specialized for photosynthesis. Animals do not photosynthesize; therefore, they do not need chloroplasts.
7 0
3 years ago
Read 2 more answers
Other questions:
  • What are cloud seeding?
    8·1 answer
  • Which molecules are able to pass through the semi-permeable membrane
    5·1 answer
  • What do sea stars have on the bottom of their feet that allows them to stay anchored on a rock or at the bottom of the ocean? A.
    14·2 answers
  • 16
    7·1 answer
  • Think about how the geologic time scale was created and how it is divided. Then answer the following questions.
    15·1 answer
  • The ___ of the cell directs cell activity and acts like the control center
    11·2 answers
  • CAM Photosynthesis occurs in plants like pineapple and cacti. This specialized type of photosynthesis is utilized to reduce
    6·1 answer
  • Within plant cells, ____ contain enzymes, chlorophyll, and other
    7·2 answers
  • When looking at each pair, how many chromosomes<br> in each pair come from the mother and father?
    14·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!