Describe the function of the filamentous structures pictured below.

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

In an area with plants that have thick, small leaves or no true leaves at all, which of the following other conditions are most

Stells [14]

The correct option is B.
The area described in the question given above is desert. Most plants in the desert either have small leaves or no leave at all, in order to regulate the amount of water that is lost to the atmosphere via evaporation of water from the leaves. Most deserts are found within the latitude 30 degree north and latitude 30 degree south. Some deserts can also be found around mountain. The temperate range in desert is quite wide. During the day, the temperature may be as high as 50 degree Celsius and the temperature may drop below zero degree Celsius in the night. Thus, it is always very cold at night compares to during the day.

8 0

3 years ago

What is the volume of a cell, in other words, what cell part are we talking about?

Hunter-Best [27]

Answer:

100 µm^3

Explanation:

the volume of a human cell is 100 µm^3

5 0

3 years ago

The pyramidal motor tract carries signals from the motor cortex of each cerebral hemisphere to _______ side(s) of the spinal cor

Natalija [7]

Answer:

Explanation:

the contralateral / both the ipsilateral and contralateral

6 0

2 years ago

What can result from weakening of digestive smooth muscle with age?

Alex17521 [72]

Answer:

Weakening of digestive smooth muscle with age can cause constipation.

Explanation:

Smooth muscles in the digestive system have the role to move food down the tract via radially symmetrical contractions (peristalsis). With age, the function of smooth muscles reduces, causing the food to move more slowly through the alimentary canal (digestive tract). As a consequence, water gets absorbed from food waste, which can cause constipation.

8 0

3 years ago