1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sp2606 [1]
3 years ago
5

What chromosomes can the males sperm give to the offspring?

Biology
1 answer:
Leni [432]3 years ago
4 0

Males tend to determine the sex of the baby depending on whether sperm is carrying and X or Y chromosome. An X chromosome combines with a mothers X chromosome to make XX (Girl). A Y chromosome from a male will combine with a mothers X chromosome to make an XY (Boy).

Males always pass on the Y chromosome

You might be interested in
Which statement BEST describes a lifestyle with healthy eating habits? A. John and his family follow a diet plan that consists o
Ierofanga [76]
Option C: Andrew is a wrestler and needs to stay at a consistent weight. In order to do so, he follows the dietary recommendations of a dietitian carefully and always maintains a balanced diet.<span />
6 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
The atomic number of carbon is six, which means that a carbon atom has six protons. Carbon has three naturally occurring isotope
Sati [7]
Idk tbh I just need to answer for I can get help
5 0
4 years ago
In which column on the chart below would the information below best fit for a mode of reproduction, CANNOT REPRODUCE WITHOUT A H
Alisiya [41]

Answer:

B. Virus.

Explanation:

Hello.

In this case, since bacteria (A.) reproduce via asexual reproduction via mitosis and the animal (D.) and vegetal (C.) cells could reproduce via sexual or asexual reproduction depending on the organism, they do not need a host to start the replication of the DNA and therefore reproduce. In such a way, it is widely known that viruses need a host that facilitates the replication of their DNA or RNA (depending on the virus) since they only have their genetic information but they do not have neither the RNA nor the DNA polymerase that favor such process, that is why they need a host.

Best regards.

5 0
3 years ago
When you are exposed to sun light for a long time your skin which otherwise appears normal gets heavily tanned what could be the
vovangra [49]
"<span>The genes for melanin pigmentation remain turned on and prepare more melanin than usual to protect the skin from photo-damage when it is exposed to sunlight for long time" is the actual reason. </span>
5 0
3 years ago
Other questions:
  • BRAINLYEST IF CORRECT! 2 QUESTIONS. HELP FAST PLEASE!!
    11·1 answer
  • Identify the types of genetic recombination.
    9·1 answer
  • When nerve cells in the nervous system cease to divide, they are in
    5·1 answer
  • Which of these lists the components of a reflex arc in the correct sequence? Which of these lists the components of a reflex arc
    9·1 answer
  • What are ways mountains can form along plate boundaries
    6·1 answer
  • Other than going through the same phases/ names, give 2 similarities between mitosis and meiosis
    15·2 answers
  • Explain how deposition in a basin leads to the formation of sedimentary rock
    10·1 answer
  • Because the achromatic spindle is important in the mitosis process
    11·1 answer
  • An astronomer observes the light of a galaxy that is 600 million light-years away. How old is the light?
    11·1 answer
  • Help I will give brainliest
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!