1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katarina [22]
3 years ago
9

What is the most important similarity between sumer and babylon?

Biology
1 answer:
Gala2k [10]3 years ago
5 0
An area in the South region Babylonian in present - day Iraq
The chief City of ancient Mesopotamia and capital of the ancient kingdom of Babylonia
You might be interested in
The purpose of metaphylaxis is to:
Sphinxa [80]
(C) both cure and prevent disease among entire population of animals.
7 0
3 years ago
What three organic molecules make up the cell membrane​
Studentka2010 [4]

phospholipids, glycolipids and sterols

4 0
3 years ago
A client in the emergency department is diagnosed with a communicable disease. When complications of the disease are discovered,
n200080 [17]

Answer: C. Measles

Explanation:

Measles is a contagious disease which is caused by the Rubeola virus. It is an airborne disease which spread easily through sneezes and coughs of the infected person. It may also caused due to direct contact with the nasal secretions. It can spread when people share a common living space and lack immunity to fight against the disease causing symptoms.

The symptoms include cough, inflamed eyes, red rashes all over the body and begins with fever.

On the basis of the above information, measles is the disease due to which the client must be placed in a respiratory isolation so as to prevent the infection to other people.

5 0
3 years ago
Study the punnett square shown here.<br> What phenotypes will be shown by the offspring?
TEA [102]

Answer:

all offspring will show the dominant phenotype for the trait

Explanation:

7 0
3 years ago
True or false. A complex machine is 2 or more simple machines working together.
gogolik [260]

Answer: False

Explanation: got this right when I calculated it.

5 0
4 years ago
Read 2 more answers
Other questions:
  • The blood flows from the atrium to ?through the ?
    12·1 answer
  • Celiac disease causes the destruction of the villi cells. Which of the following is most likely to happen to people with celiac
    9·1 answer
  • ANSWER ASAP!!!!
    8·2 answers
  • You are studying a cell line in in which one cell cycle takes approximately 24 hours. You perform FACS analysis on a population
    9·1 answer
  • a very large population of lake trout in which individual meet at random experience no migration mutation or selective pressure
    13·1 answer
  • EQ: What is the scientific Method and<br> how do we use it in our everyday lives?
    14·1 answer
  • What is the answer to 9 i’m not sure if i have it right?
    13·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • A cell is round and it is not able to produce it's own food. Which of the following organells does this cell have?
    5·1 answer
  • What are genotypes of parent 1 and parent 2 Ss Yy
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!