1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
4 years ago
14

A cell has a defect in its receptor for growth factors, preventing growth factors from attaching to and signalling the cell. Bas

ed on this, which prediction below is most likely?
A. The cell will remain dormant in GO phase.
B. The cell will grow uncontrollably and continue to divide as long as it has food.
C. The cell will replicate its DNA but be unable to begin mitosis.
D. The cell will begin DNA replication but will be unable to complete S phase.
Biology
1 answer:
morpeh [17]4 years ago
4 0

Answer:

Option B

Explanation:

B. The cell will grow uncontrollably and continue to divide as long as it has food.

Cell growth is theeoretically stimulated by the binding of growth factors to their receptors using signaling pathways.

These pathways are regulated by proteins which are encoded for in the genes.

The gene that controls the regulation of these pathway when mutated produce malfunctioning signaling protein thus not allow for regulations of the cell cycle causing uncontrollable cell division. These mutated genes are called oncogenes.

You might be interested in
What is the primary difference between diffusion and osmosis
nata0808 [166]

Long answer here!

In diffusion, particles move from an area of higher concentration to one of lower concentration until equilibrium is reached. In osmosis, a semipermeable membrane is present, so only the solvent molecules are free to move to equalize concentration.

4 0
3 years ago
What happens to warm air when it cools?
Juli2301 [7.4K]

Answer:

the temp lowers

Explanation:

7 0
3 years ago
Read 2 more answers
At what point in cell division is a chromosome lost so that, after fertilization with a normal gamete, the result is a human zyg
malfutka [58]

Answer:

The correct answer will be option-A

Explanation:

Chromosomal abnormalities are caused when the chromosome pair fails to disintegrate through a process called non-disjunction. The non-disjunction of chromosomes usually takes place at the anaphase I or II of meiosis I which involves the X and Y chromosomes.  

The abnormality observed with 45 chromosomes or reduction in one sex chromosome or 45, XO is caused when one X copy of a chromosome is completely absent in the cell.  

The cause for the loss of one chromosome is the non-disjunction during meiosis I.

Thus, option-A is the correct answer.

7 0
3 years ago
What would most likely happen to a unicellular organism if it was exposed to a hypnotic solution for an extended period or time
iVinArrow [24]

A hypnotic solution?

3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Which compound does most of the work to carry out cell processes?
    14·1 answer
  • Explain the differences between the central nervous system and the peripheral nervous system.
    8·1 answer
  • One role of the skeletal system is to produce _____.
    10·2 answers
  • Oxygen is carried by the blood stream to the cells if there is more oxygen in the blood coming from the lungs,and less in the bo
    9·1 answer
  • Q1. If a woman starts ovulating at age of 13 and stops at 50.
    6·2 answers
  • PLEASE ANSWER!!!!!! PLEASE BE SPECIFIC OR DETAILED!!!!!!
    14·1 answer
  • Using the doppler effect , astronmers can determine a stars ?
    6·1 answer
  • Where on planet Earth (in terms of latitude) the majority of Solar radiation is absorbed and explain why
    11·1 answer
  • What are threatened species?Question 1 options: species we do not have enough data for to determine their population numbers onl
    7·1 answer
  • How are the line spectra of the different elements related to the observed color with the unaided eye?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!