Answer:
More choices.
Explanation:
Cities are very densely populated because there are a lot of opportunities for a job. There are also plenty of places to send children to school. In bigger cities there are also more schools so if you were going to school you could have a choice on which school you wanted to go to. There would also be responses to bad weather such as a lot of snow the plows would be out or if there was an issue at home there are homes and shelters.
Nebula --> Protostar --> Supergiant --> Supernova --> neutron star are the right place of a high-mass star's life cycle in the correct order, from a star's birth to its death.
<h3>What is Protostar ?</h3>
Due to its growing gravity, the protostar will keep condensing. As the hydrogen atoms begin to collide, nuclear fusion will be triggered by the pressure and temperature. The start will then enter its primary sequence, when the inward and outward forces of nuclear fusion are balanced.
Thus, the words are arranged in above statement.
For more details about Protostar, click here:
brainly.com/question/13242699
#SPJ1
Answer:
La responsabilidad principal del Centro Nacional de Prevención de Desastres (CENAPRED) consiste en apoyar al Sistema Nacional de Protección Civil (SINAPROC) en los requerimientos técnicos que su operación demanda.
Explanation:
por favor, dígame si esto ayudó o no, y ¿puedo tener ideas
Answer:
d. heavy rain or snow
Explanation:
Cumulus clouds -
These are the type of cloud , with flat bases , and they appear to be fluffy , cotton like , puffy , are referred to as the cumulus cloud.
They are usually presents in line or in clusters.
They are present at lower level from the surface of earth , around 2, 000 m .
These cloud usually bring lightning , heavy rain , snow , hail with them .
Hence , from the given statement of the question,
The correct term option is d. heavy rain or snow .
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
