1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
6

What type of cell is this?​

Biology
1 answer:
Oliga [24]3 years ago
7 0

Answer: Eukaryotic cells

Explanation:

Has cilia.

You might be interested in
The resting membrane potential is primarily due to the differences in concentrations of which ions?
kompoz [17]

The resting membrane potential is primarily due to the differences in concentrations of potassium ions.

The high concentration of potassium ions in the intracellular fluid and the high permeability of the cell membrane to potassium ions in comparison to other ions are the main causes of the resting potential.

The potential across a certain cell membrane at rest is known as the resting membrane potential. It is largely determined by the potassium concentration gradient across the cell membrane or the ratio of ICF to ECF potassium in neuromuscular tissues (such as neurons, heart muscle, and skeletal muscle).

The passage of potassium, sodium, calcium, and chloride across the membrane causes variations in its permeability, which in turn affects the resting membrane potential (RMP). The differential in potentials between intracellular and extracellular areas, is acquired by the membrane once it has become polarised.

To learn more about resting membrane potential, refer from

brainly.com/question/8438145

#SPJ4

8 0
2 years ago
How will the dam most likely affect the ecosystem around the river?
Amiraneli [1.4K]
The answer is D because there would be no floodwaters
4 0
3 years ago
Read 2 more answers
What is one way that financial institutions benefit the economy?
Anit [1.1K]

Answer:

By providing loans so people can open businesses

Explanation:

4 0
3 years ago
Read 2 more answers
The large opening at the base of the skull through which the spinal cord passes is an important clue to evolutionary relationshi
liraira [26]

Answer:It is called The Foramen Magnum

Explanation: It is a large oval opening linking the Spinal cord and the Brain

Hope this helps : )

3 0
4 years ago
The light reactions of photosynthesis generate high-energy electrons, which end up in __________. the light reactions also produ
almond37 [142]
1) ATP synthase
2) NADPH
3) ATP
7 0
4 years ago
Other questions:
  • Can muscles contract if there isn't any free calcium in the cell?
    14·1 answer
  • What are the three challenges of life for organisms
    5·2 answers
  • What is an important function of the intestinal villi crypts?​?
    8·1 answer
  • Please help!!! Will mark brainliest!!!
    14·1 answer
  • Help!!!!!!!!!! What happens when a substance undergoes a chemical change?
    7·1 answer
  • The diameter of arterioles is regulated by __________.
    6·1 answer
  • Plant biotechnology is used for control of ___________.
    6·1 answer
  • Why is STR analysis preferred today?
    9·1 answer
  • transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
    7·1 answer
  • WHO EVER ANSWERS FIRST GETS BRAINLIEST
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!