Switch to anaerobic respiration
C. It would make it for difficult for animals to move around and seek resources in other areas.
Explanation:
Small patches of protect land makes it difficult for animals to move around and see resources in other areas.
Protected areas or conservation areas are locations that receive special protection because of the natural diversity found in them.
- Protected areas in some places are the last refuge for animals and plant species for safety.
- The larger a protected area is, the better and more advanced an organisms niche can be.
- A small protected area limits the niches of roaming animals and makes it difficult to seek for resources out of their limited scope.
Learn more:
Conservation brainly.com/question/8690489
#learnwithBrainly
Answer:
Trait
Explanation:
We call a specific variant of a character a phenotypic trait.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.