1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
4 years ago
7

In mammals, air enters lungs through tubes called , which branch into smaller tubules called , which extend out to tiny air sacs

called . trachea; bronchioles; spongy tissue. bronchi; bronchioles; alveoli. bronchi; alveoli; gills.
Biology
2 answers:
Alex777 [14]4 years ago
5 0
Bronchi, bronchioles, alveoli
Anton [14]4 years ago
4 0

Answer:

The answer is Bronchi; Bronchioles; Alveoli.

Explanation:

Air enters the lungs through the Bronchi which are two terminal branches of the trachea that enters each lung. Within the lung, the bronchi branch extensively, giving rise to increasingly thinner ducts, known as the bronchioles, which terminate in the alveolar ducts. The alveolar ducts lead to small sac-shaped structures surrounded by a dense network of blood capillaries called pulmonary alveoli.

You might be interested in
Please helpppppppppppppppp
LenaWriter [7]
Switch to anaerobic respiration
7 0
3 years ago
Read 2 more answers
One reason why small patches of protected land could be disadvantageous is ____.
Veseljchak [2.6K]

C. It would make it for difficult for animals to move around and seek resources in other areas.

Explanation:

Small patches of protect land makes it difficult for animals to move around and see resources in other areas.

Protected areas or conservation areas are locations that receive special protection because of the natural diversity found in them.

  • Protected areas in some places are the last refuge for animals and plant species for safety.
  • The larger a protected area is, the better and more advanced an organisms niche can be.
  • A small protected area limits the niches of roaming animals and makes it difficult to seek for resources out of their limited scope.

Learn more:

Conservation brainly.com/question/8690489

#learnwithBrainly

7 0
3 years ago
Pyrolobus fumarii, an extreme thermophile, can survive at a temperature as high as 113°C. This microorganism could be categorize
KengaRu [80]
 the answer is archaeabacteria

4 0
3 years ago
What do we call a specific variant of a character?<br> A.gene<br> B.trait<br> C.locus
Aneli [31]

Answer:

Trait

Explanation:

We call a specific variant of a character a phenotypic trait.

5 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
4 years ago
Other questions:
  • He _____________ rate is the level at which a population remains stable.
    12·1 answer
  • How much energy flows from one level to another in the food chain??
    5·1 answer
  • What does the messenger RNA codon GUU and GCA code for
    14·1 answer
  • What defines the carrying capacity of a particular species?please help
    14·2 answers
  • The heat transfer depicted in the image is MOST likely
    7·2 answers
  • An insect eats a leaf. Explain how the insect depends on the sun for energy.
    12·1 answer
  • Structures in plant leaves open and close to maintain homeostasis are called
    5·1 answer
  • The Milky Way galaxy was given its name because of what it looks like when viewed from Earth.
    7·2 answers
  • How is life going for everyone talk to me mines is saf
    10·2 answers
  • How are the Archaeabacteria different from the Eubacteria?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!