1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luda [366]
3 years ago
12

Match the structure of the macromolecule to the description of the function:

Biology
1 answer:
Vadim26 [7]3 years ago
6 0

Answer:

  • Numerous amino acids <u>allow for proteins to perform many diverse functions in organisms</u>.
  • The branching structure of some carbohydrates <u>maximize the amount of glucose available for quick energy</u>.

Explanation:

Amino acids are the <u>building blocks</u> of proteins. In humans, <u>all forms of proteins</u> are made up of <u>20 different types of amino acids</u>. The <u>sequence of amino acids</u> is the key to the production of <u>specific proteins</u>. If the sequence is changed, the target protein will be changed. So, only 20 types of amino acids can produce millions of proteins through different combinations. For example, for a protein with 4 amino acids sequence, 160,000 types of polypeptide chains can be formed (20 X 20 X 20 X 20). Since we know that proteins are key players in cell functioning, their multiple combinations lead to diverse functions in the organisms.

Carbohydrates are an <u>excellent source of energy</u>. Although branching decreases the water solubility of carbohydrates, it <u>compacts the energy-yielding monomers</u> in a <u>small space</u> so that they can be <u>stored</u> and, during starvation, they can produce an <u>extensive amount of energy</u> for long term survival. Carbohydrates in <u>animal and plant</u> bodies are stored as branched structures of <u>glycogen and starch</u>, respectively.

You might be interested in
A fox eats a steady diet of rabbits. No matter how many rabbits the fox eats, he will never start to look like a rabbit, though.
aivan3 [116]

Answer:

Because that's just how it works.

Someone can eat a steady diet of steak and potatoes but they don't turn into steak and potatoes.

When we eat, we consume the meat and energy of the animal. We don't consume some mystical part of them that gives us their qualities.

For example:

You can eat deer meat and not get as quick as a deer, or lion meat and not get the courage of a lion.

We can apply this to the "You are what you eat" phrase people like to use.

Just because you eat a lot of donuts, for example, doesn't mean you'll turn into a donut, or get any donut like qualities (Except maybe stickiness).

Foxes eat rabbits to be healthy, and <em>alive, </em>not to eat plants and hop around and 50 thousand kids

I hope this wasn't too sarcastic-

Rereading it, it kinda came off like that-

Hope this helps though?

Explanation:

8 0
3 years ago
A scientist found fossils of trilobites in a field. Trilobites are now extinct, but lived in water when they were alive. What ca
sesenic [268]

Answer:

they can conclude that they was not as extinct as you think they was.

Explanation:

in my opinion if im wrong tell me.

3 0
4 years ago
The three types of ocean floor sediments are classified according to their _____
Pie
<span>Origin

....................................</span>
6 0
3 years ago
Read 2 more answers
What would happen if introns were not removed during RNA processing?
Alchen [17]

Answer:the answer is

The protein would be incorrect and the protein might not function

8 0
3 years ago
Translate this RNA strand into amino acids
Ostrovityanka [42]

Answer:

AGUUCAGUAAUC

Explanation:

This might be slightly wrong, it was somewhat difficult for me to keep up with which letter I was on. Adenine always pairs with Uracil and Guanine always pairs with Cytosine.

3 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which animal is the only creature that has legs but can't walk on them?
    6·1 answer
  • Organisms use energy for all chemical processes. together, all of these processes are called
    14·1 answer
  • Two common species of frogs from the genus Bombina (B. bombina and B. variegata) live in similar latitudes and ecological condit
    5·1 answer
  • If the DNA of a representative species from each of the major kingdoms was examined, the sequences coding for which of following
    10·1 answer
  • Louis Pasteur's experiments showed that bacteria did not grow in a flask unless they first entered from the surrounding environm
    7·1 answer
  • 4. When one nucleotide contains adenine, what type of base is the adenine attached to on the
    11·2 answers
  • 4. The gravitational pull of Jupiter is greater than the gravitational pull of Earth. How
    14·1 answer
  • Male cones produce ______ which contains cells that develop into sperm.
    10·2 answers
  • Complete the following sentence:_____ or _______ meaning some can live without _____
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!