1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
charle [14.2K]
3 years ago
11

8. Why do all drug cases have to have the drugs analyzed before court?

Law
2 answers:
dusya [7]3 years ago
5 0

Answer: They do it because it might look like cocaine or LSD but that doesn't mean it actually is

Explanation:The prosecution must prove that a seized substance is indeed the illicit drug it claims it is by sending the evidence to a crime lab for analysis. The crime lab analyst then must testify at trial in order for the prosecution to make its case.

Ierofanga [76]3 years ago
4 0

All drug cases have to have the drugs analyzed before court to determine the possessed material contains an illegal substance or not.

<u>Explanation:</u>

Particularly in the drug cases in the USA, the law enforcement officer has to prove the criminal charges to enable the court to quantify the quantum of punishment for possession of a drug.

So, the forensic department as to ascertain the substance or the material which has been confiscated from the criminal contain any particle which is considered to be illegal. The forensic result will be submitted to the court through the law enforcement officer for the prosecution to make it a fit case for trial.

You might be interested in
How to citizens act to help police improve arrest rates
s344n2d4d5 [400]

Answer: Citizens should report any suspicious activity, and victims of sexual assault or domestic violence need to tell police ASAP, as many of these victims do not alert police because they feel isolated or helpless

Explanation:

7 0
4 years ago
Read 2 more answers
Identify two current issues in American politics. (2020-2021)
amid [387]

Answer: 1.) Corona virus 2.)Mail in ballots

Explanation:

3 0
3 years ago
Read 2 more answers
In the US correctional system, the aspect of
irinina [24]

Answer:

amen .........,.......

5 0
2 years ago
How are crime and the penal code related?
SSSSS [86.1K]
The penal code generally refers to the criminal code. The criminal code includes crimes and there punishments. So, when someone faces the law for committing a crime, the penal code contains the penalties that they may face.
7 0
3 years ago
The courts sometimes will reform contracts when they determine that there are inconsistencies in the contract or that the contra
icang [17]

Answer: Firstly , the legal concept on Estoppel will allow the court to do so.

Explanation:

7 0
3 years ago
Other questions:
  • The question above from where it says one a scale one to ten
    11·1 answer
  • Which amendment did law enforcement officer James Harris violate in the scenario?
    11·2 answers
  • ¿Dónde se encuentra el hilo/la conexión en el DESASTRE AMBIENTAL/ Y LA CONCIENCIA INDIVIDUAL?
    10·1 answer
  • What age do you have to be to get a business bank account
    11·2 answers
  • The purpose of competition policy ​
    13·1 answer
  • How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
    15·1 answer
  • What is the purpose of the Vehicle Exception?
    14·1 answer
  • Which action can lead to intentional injuries?
    14·2 answers
  • Discuss the pros and cons of raising children in correctional institutions. How you expand or limit such programs?
    13·1 answer
  • A good team member ________________. does the least amount of work possible is actively engaged in the group doesn't let anyone
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!