Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
The answer is <span>Lysosomes
Lysosomes are the organelles in charge of digesting and breaking down all matter in a cell that needs to be broken down, varying from food and energy molecules to viruses and bacteria.</span>
Answer: unfavourable ph condition for the pepsin
Explanation: during digestion, enzymes are needed to aid the process.digestive enzymes are biological catalyst that breakdown large food particles into digestible form .
As biological catalyst, enzymes require an optimum temperature and pH condition.outside this temperature or pH,the enzyme is denatured.
In the stomach, hydrochloric acid is required to convert pepsinogen into it's active form,pepsin.the acid also creates an optimum low pH that pepsin needs to function.
As the food moves to the small intestine,the pH is alkaline and is unfavourable for pepsin to function.