1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fiesta28 [93]
3 years ago
8

Which is a sustainable practice?

Biology
2 answers:
Ostrovityanka [42]3 years ago
7 0

Answer:

A. wind farms

EleoNora [17]3 years ago
5 0

Answer:

Wind farms

Explanation:

You might be interested in
Bone-forming cells that produce collagen and proteoglycans and release matrix vesicles are Multiple Choice
SVETLANKA909090 [29]

The bone-forming cells that produce collagen and proteoglycans and release matrix vesicles are called <u>Osteoblasts</u>

<h3>What is skeletal system?</h3>

They are part of the skeletal system. The skeletal system is made up of bones, ligaments, cartilages and tendons. There are 206 bones in the human body.

Learn more about bones:

brainly.com/question/1283837

7 0
3 years ago
What mass of oxygen reacts when 4.50 moles of water are produced?
denis23 [38]

Answer:

120 g

Explanation:

mass of reactants+ mass of products=one mole of oxygen= 120 g

6 0
3 years ago
When viewing a plant cell with the low power objective 10x and an ocular of 10x what is your total magnification?
natima [27]
To find the magnification you have to multiply the power of the objective by the power of the ocular

So the magnification would be 10x10= 100x
7 0
4 years ago
Read 2 more answers
Which two structures contain DNA
schepotkina [342]

Answ

Micronucleus and macronucleus

Explanation:

7 0
3 years ago
Explain what causes the different seasons on Earth.? Science
weqwewe [10]
Earth has seasons because its axis is tilted.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Most fungi carry on external digestion.<br><br> True<br> False
    11·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • The punnet square predicts the ratio of genotypes in the offspring, based on the genotypes of the parents. In this cross, tallne
    11·2 answers
  • Use your knowledge of inheritance (the passing of traits from parents to offspring) to explain why
    7·1 answer
  • 5. Match each term with its definition or characteristic.
    7·1 answer
  • Which is the definition of adhesion?
    8·1 answer
  • What is chesse also im 3 years old jk
    5·1 answer
  • What type of
    11·1 answer
  • When the water turns yellow which gas is most common
    9·1 answer
  • Using less water is one way to practice water
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!