1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nezavi [6.7K]
3 years ago
14

Should genetically modified foods be allowed in the United States?

Geography
1 answer:
Mkey [24]3 years ago
5 0

Answer:

No

Explanation:

They do nothing but cause destruction in the human body and i believe its one of the causes for over weight people.

You might be interested in
How many words are in the gettysburg address
Fantom [35]

There are 272 words in the Gettysburg Address!

Sunny~ ☺

4 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Bankers, merchants, and government builders in Rome belonged to the ___________ class.
mixer [17]
Bankers , merchants, and government builders in Rome belonged to the equestrian class.
4 0
3 years ago
The main reason Thomas Paine publish Common Sense was to​
SIZIF [17.4K]

Answer: to persuade the coloniests that the colonies should become independent.

Explanation:

6 0
3 years ago
Horizontal moves occur along plate margins
masha68 [24]
? I don’t understand the question?
8 0
3 years ago
Other questions:
  • Why the 2005 elections in Afghanistan were so important
    10·1 answer
  • About ____ of Canada's entire population lives in the southern lowlands of Ontario. A. One-twelfth B. one-eighth C. one-third D.
    5·1 answer
  • Although these devices can be of great value to archaeologists, some users of this popular type of magnetism-based remote-sensin
    10·1 answer
  • What continent is Chad in?
    11·1 answer
  • What cultures helped to shape the Renaissance?
    5·2 answers
  • 16. Which process(es) cause(s) thick sediment layers to accumulate along the boundaries of continental
    13·2 answers
  • Explain the cause of daily tides. What human activities do the tides affect and how?
    7·1 answer
  • A geographical map of South America and part of North America. Parts of the map are labeled A, B, C, and D. A is in Mexico. D is
    15·1 answer
  • Which type of seismic wave is recorded by a seismograph first during an earthquake
    5·1 answer
  • Which of the following is not a tool of Geography that allows us to see the world spatially?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!