1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aliun [14]
3 years ago
5

In a litter of kittens, some of the kittens have coloring that is completely different from their parents. What is the explanati

on for this?
A. Crossover during meiosis

B. The placement of the genes on the parent chromosomes

C. Chromosomal aberrations during meiosis
Biology
1 answer:
lara31 [8.8K]3 years ago
3 0
<span>In a litter of kittens, some of the kittens have coloring that is completely different from their parents.
because of 
</span>The placement of the genes on the parent chromosomes
and crossing over also play some role in it
so i conclude most appropriate answer is B
hope it helps
You might be interested in
What controls the direction of a molecule, such as oxygen, involved in passive transport?
Grace [21]
The nucleaus controls everything within cells

4 0
3 years ago
What does it mean to be sustainable?
lord [1]

Answer:

To be sustainable is to be able to maintained at a certain rate. It's to keep things continuous and viable. For example, wind energy is sustainable compared to oil because wind is easier to get than oil. Another example is if a country only has about 10-13 crimes a year for 20 years, crime is sustainable in that country.

8 0
3 years ago
What are the 3 elements that cause seasons?
Kaylis [27]
1 earth axis 2 sunlight 3 elevation
7 0
3 years ago
The timing in the cell cycle in eukaryotic cells is believed to be controlled by a group of closely related proteins called
arsen [322]
The answer would be cyclins hope it helps<span> </span>
6 0
3 years ago
What capability distinguishes trauma centers from​ less-specialized hospitals?
Igoryamba

Trauma centers are care facilities equipped and staffed to provide care for patients suffering from every aspect of injuries. The capability that distinguishes trauma centers from less-specialized hospitals is that trauma centers provides 24-hours in-house coverage by general surgeons, and quick availability of care in specialties such as neurosurgery, anesthesiology etc.






8 0
3 years ago
Other questions:
  • Help! 5 questions for 20 points &lt;3
    5·1 answer
  • A student designs an electromagnet, as shown in the picture. The electromagnet is only able to pick up 1 paper clip. List 2 modi
    6·1 answer
  • What are the wavelike muscle contractions that help move food along the digestive tract?
    12·2 answers
  • Which statements are true regarding blood pressure in older adults? Select all that apply?
    13·1 answer
  • What is the polymer of nucleic acid?
    14·2 answers
  • Suppose that a rabbit breeder notices two individuals in a litter with large, round noses and names this trait the clown trait.
    7·1 answer
  • In dogs, the trait for aggressiveness is recessive and is represented with a. Mild-mannered dogs show the dominant trait, repres
    5·2 answers
  • What are the parallels? What are the differences?
    13·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What can we see with electron microscopes that we can't with light microscopes?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!