Classification of living things takes into consideration of everything, except A. The number of cells the organism is found to have.
The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
Answer:
We get the materials to make new cells through...
biosynthesis, which puts small organic molecules together to create larger molecules.
Explanation:
Biosynthesis is the process in your body that turns simple structures into more complex structures. It can happen within a single cell (or within a single organelle within a cell), or across multiple cells. In this case, multiple, since it is referring to humans.
Either this option or A.
Answer: gravity and an environmental factor
Explanation: