1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hunter-Best [27]
3 years ago
15

Explain in detail the plausibility of a volcano erupting in Odessa, TX.

Biology
1 answer:
Arada [10]3 years ago
4 0

Answer:

Deep within the Earth it is so hot that some rocks slowly melt and become a thick flowing substance called magma. Since it is lighter than the solid rock around it, magma rises and collects in magma chambers. Eventually, some of the magma pushes through vents and fissures to the Earth's surface

Explanation:

USGSwww.usgs.gov

You might be interested in
While some aspects are based on body composition is largely a result of?
Alexxx [7]
Body composition:<span>is the percentage of person's total body weight that is made up of adipose (fat) tissue as opposed to lean body tissue is known as their body composition. Disease risk is closely related to body composition.

</span>
5 0
3 years ago
Read 2 more answers
Base your answer to the question on the passage below and on your knowledge of biology
Delvig [45]

Darwin concluded that the finches all shared a common ancestor but had  developed different beak structures.  The second sentence best describes as an ecosystem.

Explanation:

  • When Charles Darwin traveled to the Galapagos Islands, he observed 14 distinct varieties of finches on the islands Darwin also observed that each finch variety  ate a different type of food and lived in a slightly different habitat from the other finches, Darwin concluded that the finches all shared a common ancestor but had  developed different beak structures. The second sentence best describes as an ecosystem.
  • An ecosystem is a huge group of living organism such as plants,animals, micro-organisms in a particular area.
  • An ecosystem is a community of living organisms related with the nonliving components in the  environment, together interacting as a system.
  • its abiotic constituents, includes minerals, climate, soil, water, sunlight, and all other nonliving elements, and its biotic constituents, consists of all its living members.

4 0
3 years ago
Which of the following represents a duplication in the DNA sequence A-G-T-C-T?
dimulka [17.4K]

Answer:

wym i canr see the examples

Explanation:

6 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Homeostasis will be most affected by the removal of what
vivado [14]
Hyppocamus is the eternal body thermostat. If the hyppocamus is removed it would cause a major effect on homeostais.
7 0
3 years ago
Other questions:
  • Which of the following applies to a viral infection
    11·2 answers
  • Why is protein synthesis different in prokaryotes and eukaryotes?
    8·2 answers
  • Adaptors are _____.
    8·2 answers
  • A human skin cell contains 46 chromosomes.A frog sperm cell contains 12 chromosomes.which pair of number shows the chromosomes n
    12·1 answer
  • Summarize the bonding properties of carbon
    13·1 answer
  • What kind of organisms were missing from the first classification system?
    14·1 answer
  • Is the weathering a constructive or destructive force? why?
    12·1 answer
  • The _____ is sometimes described as the executive functioning area of the brain.
    11·1 answer
  • WHAT IS The food chain is
    13·2 answers
  • Write a short essay on how will you protect natural resources.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!