1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cestrela7 [59]
3 years ago
12

Most scientists agree that

Biology
1 answer:
Tems11 [23]3 years ago
6 0

C. Living organisms share ancestry.

You might be interested in
True or false? Peptidoglycan is a polysaccharide found only in bacteria.
Trava [24]
It’s True..................
......
.........
6 0
4 years ago
The sediments along the side of this stream are an example of ____.
Allushta [10]
If the sediments are put down, it's deposition
If the sediments are being moved, it's erosion
6 0
3 years ago
Read 2 more answers
A newly mated queen ant establishes a nest in an unoccupied patch of suitable habitat. Assuming that no disasters strike the nes
Alika [10]

Answer:

Logistic

Explanation:

As the newly mated queen inhabit the new habitat, the population of the ants would increase slowly first followed by a rapid increase in the population size. Once the population size reaches the carrying capacity, it is leveled off.

Carrying capacity is the maximum number of the individuals of a population that can be supported indefinitely by a habitat. Once the population reaches the carrying capacity, one or other required resources become limited which in turn does not allow the exponential growth of the population.

This type of population growth wherein the exponential increase is followed by leveling out the population as the carrying capacity is reached, is called logistic population growth.

8 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
Consider a human with a genotype aabbccddeeffgghh. how many different types of gametes could this individual produce, assuming t
Vilka [71]
Only one ...as there is no heterozygous unit !
8 0
3 years ago
Read 2 more answers
Other questions:
  • Ling, a 75-year-old grandmother, complained that her vision was becoming obscured. Upon examination by an ophthalmologist she wa
    8·1 answer
  • 8. What does being called a “carrier” for a specific trait mean?
    5·1 answer
  • Dna is located in a non membrane bound region in a prokaryotic cell called the
    7·1 answer
  • identify solar wind nuclear and tidal power as nonrenewable or renewable energy resources. Explain your answer.
    12·2 answers
  • Which group of chordates has a notochord and includes separate males and females?
    11·1 answer
  • If a control group is NOT included in an experiment, it would be difficult to
    14·1 answer
  • PLZ HELP A FELLOW HUMAN OUT!! Science question attached.
    10·1 answer
  • 3419059779 ppppppppppppppp1234​
    6·1 answer
  • What is a bacterial have?
    10·2 answers
  • In order to detect an odor, molecules must first dissolve in the ____________ before they bind to the receptor sites of the ____
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!