4 years ago

Explain why cells don’t just continue to grow larger as organisms grow larger. Why do cells divide?

1 answer:

7 0

Answer: Cell divide because of the surface area to volume ratio. If the surface area to volume ratio is too small, mitosis and other processes that are in the body will not work. The surface area needs to be larger than the volume of cells for these processes to strive.

You might be interested in

7247.acellus.com/StudentFunctions/Interface/acellus_engine.htmlClassID=11402

Ivahew [28]

Answer:

An abundance of food.........

5 0

3 years ago

Plants can break large rocks into tiny pieces. How is it possible for plants to be able to mechanically weather rocks by breakin

lidiya [134]

Answer:

The roots of the plant grow into the cracks of the rock forcing the rock to break.

Explanation:

Hope this helps

6 0

2 years ago

Carol is enjoying eating her dinner. While eating, she notices that her saliva secretion is higher than normal and that she feel

Svet_ta [14]

Parasympathetic nervous system

3 0

3 years ago

An organism is multicellular, has chloroplasts, and is made up of eukaryotic cells. In which domain would a scientist place this

il63 [147K]

An organism is multi cellular, has chloroplasts and is made up of eukaryotic cells will be placed in Eukarya domain by a scientist. The domain Eukarya arose more that 1.7 billion years ago. It originated from the first prokaryotic organisms. I hope that this is the answer that you were looking for and hope that it helps you.

4 0

3 years ago

PLS HELP ME WITH THIS!!! What is the nucleotide sequence of the mRNA strand you built?

Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0

3 years ago

Read 2 more answers