1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adelina 88 [10]
4 years ago
6

Explain why cells don’t just continue to grow larger as organisms grow larger. Why do cells divide?

Biology
1 answer:
telo118 [61]4 years ago
7 0

Answer: Cell divide because of the <u>surface area to volume ratio</u>. If the surface area to volume ratio is <u>too small</u>, mitosis and other processes that are in the body will <u>not work</u>. The surface area needs to be<u> larger than the volume of cells for these processes to strive.</u>

You might be interested in
7247.acellus.com/StudentFunctions/Interface/acellus_engine.htmlClassID=11402
Ivahew [28]

Answer:

An abundance of food.........

5 0
3 years ago
Plants can break large rocks into tiny pieces. How is it possible for plants to be able to mechanically weather rocks by breakin
lidiya [134]

Answer:

The roots of the plant grow into the cracks of the rock forcing the rock to break.

Explanation:

Hope this helps

6 0
2 years ago
Carol is enjoying eating her dinner. While eating, she notices that her saliva secretion is higher than normal and that she feel
Svet_ta [14]
Parasympathetic nervous system
3 0
3 years ago
An organism is multicellular, has chloroplasts, and is made up of eukaryotic cells. In which domain would a scientist place this
il63 [147K]
An organism is multi cellular, has chloroplasts and is made up of eukaryotic cells will be placed in Eukarya domain by a scientist. The domain Eukarya arose more that 1.7 billion years ago. It originated from the first prokaryotic organisms. I hope that this is the answer that you were looking for and hope that it helps you.
4 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Choose which way of evolution caused the FQ antibiotic resistance.
    13·1 answer
  • Since the early 1990s, geneticists have produced ____________ crops that yield fruits and vegetables commonly found in U.S. supe
    9·2 answers
  • What are the 4 basic steps for DNA extraction?
    9·1 answer
  • What is the oldest type of bacteria
    13·1 answer
  • Which condition can cause a population crash?
    11·1 answer
  • After researching the possible effects of music, Elaina proposes that if people listen to faster-paced music, their pulse rates
    12·1 answer
  • PLSS HELP how is gene knockout similar to gene sequencing?
    11·1 answer
  • Which law of thermodynamics
    7·1 answer
  • WILL GIVE BRAINLIEST!! PLEASE HELP!!
    6·1 answer
  • The inside of the barrel-shaped ldl protein consists of ___________ amino acids, while its outside portions in contact with the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!