Answer:
Answered
Explanation:
The Board of Nursing was created in year 1911 by an Act of the State Legislature and it was signed into law by former Governor Mr. Ben W. Hooper.
1. Elizabeth Lund, who is a Registered Nurse working as an Executive Director in the Board of Nursing.
2.The board's mission is to safeguard the health, safety and welfare of Tennesseans by requiring that all who practice nursing within this state are qualified and licensed to practice. Board's responsibilities include 3 functions a) licensing b) education and c) practice.
Answer:
This question is incomplete due to lack of needed map/image, but the attached one is related with it. Correct answer is: D) 4
Explanation:
Sahel is the region to the south of Sahara Desert in the northern part of Africa, and it streches from Atlantic coast in the west (Mauritania) to Red Sea coast in the east (Sudan). It is some 5,500 kilometers wide.
In the attached map Sahel is shown in <em>yellow color</em>, and it is part of Dry Zone (more precisely Semi-arid climate). Semi-arid climate means that this is transitional zone between dry desert in the north and seasonally wet African savannas in the south.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
<h2><u>Answer:</u></h2>
For the right triangle to be given in name of three letters such as this, the right angle is most likely to be in the center, in this case letter K. To determine the common trigonometric properties of a certain angle we may use of the mnemonics SOH - CAH - TOA.
sin angle = opposite side / hypotenuse
cosine angle = adjacent side / hypotenuse
tangent angle = opposite side / adjacent side
If we let small letter j, k, and l be the sides opposite to angles J, K, and L, respectively. Then, the cos (L) will be,
cos (L) = j/k
