1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol13
2 years ago
6

Before Viewing How would YOU define this word or term?

Biology
1 answer:
zhuklara [117]2 years ago
8 0
I don’t exactly understand the question, I’m open to help though!!!
You might be interested in
How can fossils BEST help paleontologists and biologists classify organisms?
Papessa [141]
As it grows, it helps the follicles grow into roots which help people find out about the scientific knowledge of fossils.
5 0
3 years ago
Read 2 more answers
Which interventions are part of the nursing intervention classification (nic) of pressure management? select all that apply?
ludmilkaskok [199]

Interventions are part of the nursing intervention classification of pressure management is Safety, Facilitate communication of nursing treatments to other nurses and other providers. Promote the development of a reimbursement system for nursing services.  Enables researchers to examine the effectiveness and cost of nursing care.

8 0
3 years ago
Which area has a drier climate northern Australia or north Australia
andreyandreev [35.5K]

Answer: north Austria have very dry summers and the winters are cooler and drier

Explanation:

8 0
3 years ago
When a biologist in a laboratory reports a new discovery based on experimental results, biologists in other laboratories should
Butoxors [25]
The answer would be c, obtain the same results after the experiment is done
6 0
3 years ago
Read 2 more answers
Do we get all of our energy from the sun
N76 [4]
Im pretty sure that if we got all of our energy from the sun then there would be no energy at night so no


8 0
2 years ago
Read 2 more answers
Other questions:
  • Why would a third-degree burn be less painful than a first- or second-degree burn involving the same body area?
    6·1 answer
  • What can gene therapies potentially do to treat cystic fibrosis?
    11·1 answer
  • What chemical ion is responsible for initiating the contraction of a muscle fiber?
    9·1 answer
  • Which mutagens incorporate into dna and frequently pair with the wrong base?
    8·1 answer
  • Which of the following best describes cell communication processes that are present in bacteria, yeast, and multicellular organi
    5·1 answer
  • Question 14 <br><br> Answer correctly plz.
    5·2 answers
  • _______ from the mantle rises and flows out through a vent onto Earth's surface as _______. This molten material, sometimes alon
    12·2 answers
  • a kidney cell is taken from a monkey and treated with a chemical that includes interphase to begin cell division. before being t
    5·1 answer
  • Which statement best illustrates how an organism maintains homeostasis?
    13·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!