Electricity from hydropower composes approximately 6.5 % of the total electricity produced in the United States.
A dam or other construction that alters the natural flow of a river or other body of water is used to generate hydropower, often known as hydroelectric power.
One of the world's first forms of energy, hydropower produces power when moving water spins a turbine or wheel. As far back as ancient Greece, farmers utilized it for mechanical activities like grinding grain. Additionally a renewable energy source, hydropower doesn't emit any hazardous byproducts or pollute the environment. Discover more about the development of hydropower.
Learn more about hydropower here:
brainly.com/question/22258411
#SPJ4
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
B. False. Deserts are NOT only found near the equator. The reason for that is because some deserts are dry and hot, though, some deserts are cold, cold places for example the arctic. Tundra's are also cold, but they are deserts.
Answer:- b. False.
Hope I helped ya!! xD
Durban, Africa
Morocco, Africa
well that’s all I know sorry but I hope this helped ! :)
