1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vilka [71]
3 years ago
7

I need help. Please helpppppppp

Biology
1 answer:
Rudik [331]3 years ago
4 0

Answer:

a. 4

Explanation:

tell me if i'm wrong

You might be interested in
A restriction enzyme: Please choose the correct answer from the following choices, and then select the submit answer button.
Dimas [21]

Answer:

e. All of the above.

Explanation:

  • A restriction enzyme or restriction endonuclease is an enzyme that nicks or cuts DNA on a specific location after recognizing a specific sequence.
  • Restriction enzymes are widely used in cloning and biotechnological procedures.
  • The step of recombinant DNA technology requires the acquisition of the gene of interest (GOI). This is done by cutting it out of the donor genome.
  • Restriction enzymes perform this task by cutting on specific sequences. One important characteristic of restriction endonucleases is that they introduce "sticky ends" or overhangs in the donor sequence so it can be easily incorporated into the vector.

8 0
3 years ago
The passing of genetic material from parents to offspring is called___. A. Fertilization B. Specialization C. Heredity D. Mitoti
MAXImum [283]
The passing of genetic material from parents to offspring is called Heredity.

Thus, C, is your answer.
3 0
3 years ago
The experiment that Stanley L Miller and Harold C Urey conducted regarding the origin of life from inanimate matter was conducte
nignag [31]
For giving you understanding ; we need Free O2 but Oxygen is also available in H20 right why dont we use it !!

As the early atmosphere was reducing as there was no free oxygen but it was later produced by chemoautotrophic bacteria !! Living thing release O2 in atmosphere thus making it oxidising in nature and then life evolves !!
4 0
3 years ago
Read 2 more answers
Help me with this I willl mark you brainlyest I got test due
erica [24]
Was AA, KK, and TT correct?
3 0
3 years ago
Explain the relationship between the second law of thermodynamics and the net energy of an
Anton [14]

Answer:

The Second Law of Thermodynamics is about the quality of energy. It states that as energy is transferred or transformed, more and more of it is wasted. The Second Law also states that there is a natural tendency of any isolated system to degenerate into a more disordered state

is that helpful?

4 0
2 years ago
Other questions:
  • Replace with new samples of the powders and repeat, this time adding drops of the base. Record observations in the table.
    13·1 answer
  • The layer of the uterus that is sloughed off during menstruation and creates most of the menstrual discharge is the _____.
    14·1 answer
  • Choose all the answers that apply. Which of the following organelles are found in plant cells but not in animal cells?
    8·2 answers
  • .) 12. According to cell theory, what do each of the following organisms have in common? A.They can all reproduce by spontaneous
    12·1 answer
  • In general, why might ecologists be concerned when new invasive species arrive in an ecosystem?
    10·1 answer
  • Which of the following explain why sunlight is important to aquatic ecosystem?. -Sunlight provides a source of heat energy to in
    10·1 answer
  • What is the proposed ultimate result of global warming?
    7·2 answers
  • Which forms of self-injury (si) are most common?
    7·2 answers
  • explain how sweating, vasoconstriction, and raising of hairshaft contributes to increase body temperature
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!