1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zvonat [6]
3 years ago
9

A nursing student has been assigned to care for a client with digeorge syndrome. the student has reviewed the clinical manifesta

tions of this syndrome and knows that the most frequent presenting sign is
Biology
1 answer:
Setler [38]3 years ago
3 0

The digeorge syndrome is a genetic disorder, which caused by the deletion in the chromosome number 22. This disease is characterized by the congenital heart disease, immunodeficiency, and hypocalcemia.  

In this case, the most frequent clinical manifestation is hypocalcemia. Hypocalcemia is the condition, in which the blood calcium level would be declined to a significant level.


You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Which of the following is not a benefit of genetically modified foods?
Alchen [17]

Answer:

C. Plants that do not require water?

Explanation:

This is definitely not a benefit of genetically modified foods lol

6 0
3 years ago
Which of the following is not a structure on a prokaryote?
3241004551 [841]
Prokaryotic cells doesn't have a nucleus. 
4 0
3 years ago
What evidence from the study supports the hypothesis that dogs might use a magnetic sense to navigate?
Diano4ka-milaya [45]

Answer:

Yes.

Explanation:

Yes, a new research indicates that dogs might use a magnetic sense to navigate. Dogs has world class nose which helps them to navigate to their destination but it also has a magnetic compass that helps them in navigation. The dogs use magnetic field of the earth to find out shortcut ways in the unknown land or terrain so the hypothesis is right that dogs used magnetic sense for navigation.

7 0
3 years ago
This reaction releases energy as heat explain whether the reaction is exothermic or endothermic and whether it obeys the law of
galina1969 [7]
Exothermic and it does follow the law of conservation of energy.
4 0
3 years ago
Read 2 more answers
Other questions:
  • The major function(s) of the digestive system are:
    10·1 answer
  • Which pair of terms correctly completes the diagram with (a) before spores and (B) after Spores
    6·1 answer
  • If an rna strand has 20 adenine, how many thymine would it have?
    10·1 answer
  • A biochemical explanation of the cause of mood disorders generally focuses on regulation problems with .
    15·1 answer
  • Which best describes how fossil fuels form?
    6·1 answer
  • Which of the following is true about waves?
    6·1 answer
  • Explain how the situation described in the article shows that the outside environment can help and hurt cells
    10·1 answer
  • How many pounds of pressure can a long bone like the femur withstand
    14·1 answer
  • ❥SCIENCE SUBJECT
    12·1 answer
  • Sunspots are connected with other or events solar hare A solar fare is a sudden release of energy from the Sun, which shoots hot
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!