1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hichkok12 [17]
3 years ago
5

Whats the answer? please help need to pass​

Biology
2 answers:
FinnZ [79.3K]3 years ago
8 0

I am thinking D but I'm not sure‍♀️

Mrrafil [7]3 years ago
7 0

I believe it is B. Nests

You might be interested in
What are the benefits of sexual reproduction for plant and animal species?
Tamiku [17]
Increases genetic variation, which in and of itself has extreme benefits such as protection against disease, capability to evolve, etc
6 0
4 years ago
Two species of similar-looking insects have the same coloration, although one is poisonous and the other is not. This is likely
Vadim26 [7]

Answer:

The correct answer is option d, that is, mimicry.

Explanation:

Mimicry in evolutionary biology refers to an evolved similarity between the organism and another organism of other species. The phenomenon may take place between the individuals of a similar species or between the individuals of distinct species. The main objective of mimicry is to safeguard the species from predators, resulting in an antipredator adaptation.  

The evolution of mimicry takes place when the predator witnesses a similarity between the model and the mimic and as a consequence modifies its behavior in a manner, which offers a selective benefit to the mimic.  

7 0
3 years ago
What are the consequences of coastal pollution?
salantis [7]

Answer:

1. Damage to Mangrove Ecosystems and Coral Reefs.

2. Coast Damage.

3. Death of Biological Resources.

Explanation:

pollution itself is bad

8 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
All of the following protect the skin and mucous membranes from infection except
leva [86]

The question is incomplete. Th ecomplete question is as following:

All of the following protect the skin and mucous membranes from infection EXCEPT  

A) multiple layers of cells.

B) tears.

C) saliva.

D) HCl.

E) the "ciliary escalator."

Answer: D) HCl.

Explanation:

  • The epidermis, the outer layer of the skin provides waterproofing and serves as a barrier to infection and other laers also sustain any type of injury.  
  • Tears wash out foreign bodies which enter the eye. In addition, tears contain a substance called lysozyme which has an antibacterial function and works to prevent microbial invasion and infection.  
  • Saliva protects against infection, especially via the innate immune system. This mechanism is an important first-line protection against bacterial and viral infection
  • The mucociliar escalator is within the conducting airways and is composed of mucus and cilia that transfer the mucus up and out of the lungs where it can be removed by coughing or swallowing,

Whereas HCL helps in the digestion process.

Hence, the correct option is D.

5 0
3 years ago
Other questions:
  • Each myosin head contains a binding site for _____ and a binding site for _____.
    14·1 answer
  • Age, gender, species, breed, and reproductive status describe the animal's
    13·2 answers
  • please help I'm in special education class I really dont understand this I have a F in this class and its hard to understand all
    12·1 answer
  • When exercising outside on an extremely warm day, the client can feel his heart pounding very rapidly. Thinking in terms of the
    12·1 answer
  • Which of the following is not an example of an abiotic factor?
    7·2 answers
  • What reason led kary mullis to dearch for a dna polymerase enzyme?
    14·1 answer
  • Which two elements have similar characteristics?<br> Periodic Table<br> OF The Elements
    6·1 answer
  • The law of segregation states that
    5·1 answer
  • Which of the following plants is considered a type of fiber?
    5·2 answers
  • Please help meeee ! ​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!