1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gre4nikov [31]
3 years ago
11

Which organism would be the secondary consumer in this food chain? leaf insect bat cat

Biology
1 answer:
soldier1979 [14.2K]3 years ago
5 0
A bat would be the secondary consumer in this food chain as it is the second most predator like animal. 
You might be interested in
How would you compare a circle to an ellipse?
Andru [333]

Answer:

A circle is a closed curved shape that is flat. That is, it exists in two dimensions or on a plane. In a circle, all points on the circle are equally far from the center of the circle. An ellipse is also a closed curved shape that is flat.

please give brainliest

8 0
3 years ago
What is the source of energy in a food web?
MatroZZZ [7]

Answer:

A

Explanation:

The sun is what drives most processes, the sun gives energy to the plants which help them grow resulting in creatures consuming the plants.  The sun is the major source so remeber that! :D                

I am sure this is the answer so I hope this helps you!

8 0
3 years ago
Which uses of soil are discussed in the video? Check all that apply. as a habitat for animals to live in as a way to clean and s
marusya05 [52]

Answer:

3. As a place for plants and crops to grow

4. As a material to clean and smooth skin

5. As a building material for homes and buildin

5 0
3 years ago
Read 2 more answers
A forest fire caused by lightening destroys an entire forest. The population of deer was drastically reduced within the forest l
nadya68 [22]

Answer:

I'm like 90% sure that it is Gene flow

Explanation:

4 0
3 years ago
When plants undergo photosynthesis, they take in water and other nutrients from the soil and carbon dioxide from the air to prod
salantis [7]
B should be the answer
3 0
4 years ago
Read 2 more answers
Other questions:
  • Which of the following is true of coral?
    9·2 answers
  • PLEASE HURRY!!!!!!
    5·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • When doing a geographical analysis of a population, it is important to only look at one scale.
    13·1 answer
  • Which in an area located within the alpine tundra
    6·1 answer
  • Please help me with this.. very URGENT!! please!!
    11·1 answer
  • Which of the following statements best supports the claim that different organisms use different strategies for conserving energ
    6·1 answer
  • What are decomposers? give examples?????
    10·2 answers
  • What is the environmental change shown in the image?
    11·2 answers
  • A girl cycles for 3 hours at a speed of 40kn/h. What distance did she travel
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!