1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ehidna [41]
4 years ago
11

What does 'community' mean to you?

Biology
1 answer:
Yuri [45]4 years ago
7 0
A Group Of People That Work Together. They Depend On Each Other And Help Each Other Out.
You might be interested in
Suppose it were possible to conduct sophisticated microscopic and chemical analyses of microfossils found in 3.5-billion-year-ol
soldier1979 [14.2K]

Answer:

The correct answer is option 3. a nucleus.

Explanation:

The first genetic material present in the early organisms were RNA which was present in the microscopic organisms back then 3.5 billion years ago which means it is normal to have RNA in such microfossils chemical analysis.

Since, the nucleus was not present in early life forms of prokaryotes like bacteria. so, it is unusual to find nucleus in the fossils of stromatolite rocks.

Thus, option III is the correct answer.

7 0
3 years ago
What role do animal preserves play in maintaining ecosystem biodiversity?
monitta

Answer:

Animals preserve play very important role in maintaining ecosystem biodiversity. In animal preserves, animals are protected from the harmful effects of the changes which occur in the environments due to human intervention. In animal preserves,

animals should be kept in proper environment and provide a proper place for living and food in order to increase the population of the animals.

4 0
3 years ago
When a comet gets near the Sun, it starts to melt, leaving behind small pieces. What happens when the Earth moves through a come
Dahasolnce [82]

Answer:

c the comet turns into a shooting star and is gone forever

5 0
3 years ago
1. All of the parts inside the cell are floating around in the cytoplasm. The cytoplasm is most like a ___.
Elena-2011 [213]

Answer:

1 A

2 A

3 D

4 D

5 A

6 A

7 A

8 C

9 B

10 A

11 D

12 D

13 A

14 B

Explanation:

8 0
4 years ago
A celestial body orbits the Sun. It consists of rock and ice. As it passes close to the Sun, the body forms a long tail of dust.
MissTica
B. comet 
comets only have tails because the sun is shining its light on the ice and dust behind the comet
6 0
3 years ago
Other questions:
  • Which organisms would weather the rock to
    11·1 answer
  • According to the Endosymbiotic Theory, infoldings in the cell membrane of an ancestral prokaryotic cell gave rise to endomembran
    14·1 answer
  • 28) The graph below shows how the activity of an enzyme changes at different temperatures.
    5·1 answer
  • Match each piece of technology with the description of how it helps meteorologists
    8·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Compare and contrast aspergillosis and mucormycosis.
    14·1 answer
  • Which sequence of RNA transcribed from the base sequence of DNA is ATA CCG ATC GAT
    15·2 answers
  • When air particles are close together what is it called
    13·2 answers
  • In humans a widow's peak is dominant to not having widow's peak determine all possible genotypes
    9·2 answers
  • The responses observed in type IV hypersensitivities result from the action of IgG and complement. autoantibodies. IgE antibodie
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!