1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-BARSIC- [3]
3 years ago
12

Information from higher brain regions is transmitted to the medulla and cerebellum through the:________.

Biology
1 answer:
krek1111 [17]3 years ago
6 0

Answer: Option D.

Thalamus.

Explanation:

It is thalamus because thalamus is a mass of grey matter structure in the brain that is located between the cerebral cortex and the midbrain which also have some nerves connected to them and it is responsible for sending motor and sensory signals to the cerebral cortex and also regulate conciousness and mental alertness.

It transmit information from the higher brain region to the medula and cerebellum.

You might be interested in
Which of the following involves only biotic factors?
Arada [10]

Answer:

C- a duck catching and eating a snail

Explanation:

Biotic factors involve living things. The only choice with two living beings interacts would be C.

8 0
4 years ago
Which of the following is the largest particle in soil? A-clay B-sand C-silt D-humus
Akimi4 [234]

Well the soil classification is usually done on the basis of particle sizes and composition of soil.

<span>Clay </span>usually consists of particles less than 0.075 mm in size. It is a sticky soil and shows great changes in volume with variation in its water contact. It also shows considerable strength when air dried.

<span>Silt </span>has larger particles than clay and are mainly inorganic in nature. The particle size is less than 0.075mm and exhibits slightly plastic or non plastic behaviour.

Humus is soil consisting of dead and decaying organic matter. It is mainly organic in content but some inorganic particles may be mixed in it. The top soil in a tropical forest may be considered as humus.

7 0
3 years ago
Which of these is the correct sequence of smallest to largest?
vodomira [7]

Answer:

B:

Explanation:

The acorns are not to big

3 0
4 years ago
Do you believe that homicidal sleepwalking can occur? Support your position.
marishachu [46]

Answer:

there is no clear explanation why some people become violent while sleepwalking

Explanation:

Sleepwalkers who are suffering from stress, sleep deprivation, and depression do seem more susceptible to experiencing violent episodes than others, but there is no medical proof that negative emotions result in homicidal sleepwalking.

8 0
2 years ago
Read 2 more answers
Many protists can move. what are some structures mentioned that can help protists move.
Ksivusya [100]

Answer:

cilli and flagella

Explanation:

I think there is one more but not sure hope this helped

(also if spelling is weird sorry I tried)

6 0
3 years ago
Other questions:
  • How do humans obtain groudwater
    7·1 answer
  • Carbonic anhydrase is an enzyme in the human body that participates in the reaction shown below how would a person be affected i
    14·2 answers
  • An extreme-weather event has knocked out power in your community. Even with rebuilding efforts, it appears that it could be 6 mo
    5·1 answer
  • Why is it important that the phospholipid bilayer be both hydrophobic and hydrophilic?
    11·1 answer
  • In the dna molecule, thymine always bonds with thymine guanine adenine cytosine uracil
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • If a scientist removed the anthers of a flower before the flower was in full bloom, what would be the likely outcome?
    5·2 answers
  • Why are cells called the “basic building blocks of life?”
    6·1 answer
  • The human circulatory system
    15·1 answer
  • In chili peppers, hot (H) flavor is dominant over mild flavor (h). If a chili grower wanted to grow only hot peppers, which of t
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!