1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVEN [57.7K]
3 years ago
8

Why do complex organisms need specialized cells?

Biology
1 answer:
Aleks04 [339]3 years ago
3 0

Answer:

I think its A) To process bacteria...

You might be interested in
Which of these layers is typically thinnest?
valentinak56 [21]
Hello,


The answer is for sure <span>A. O horizon</span>.Positive.


Hope this helps
7 0
3 years ago
Read 2 more answers
Brown mice disappear from the mouse population for two generations and then reappear in the third generation. Give two possible
gizmo_the_mogwai [7]

Answer:

The trait is inherited in the homozygous recessive pattern

Possible mating is between two heterozygous individuals

Explanation:

One possible explanation for this is that the trait for this brown mice has to inherited in the homozygous recessive condition. It is possible for this trait to skip two generations and then reappear if it has to be inherited in the homozygous recessive condition.

Another explanation to complement the first is that for this trait to reappear, there was mating between two heterozygous individuals (with one allele being domiant and the other being recessive). It is possible that all matings within the two skipped generations was between an heterozygous and a homozygous dominant or between two homozygous dominant individuals which will not produce the brown mice..

5 0
3 years ago
The ecosystem is the lowest level of the biosphere hierarchy to include _______..
netineya [11]
<span>The ecosystem is the lowest level of the biosphere hierarchy to include weather patterns and soil conditions. in the whole biosphere hierarchy, ecosystem actually placed as the second highest (1 place below biosphere) But there are only 2 hierarchy that include weather and soils, and those hierarchies are biosphere and ecosystem. So technically the ecosystem will be the lowest in this matter</span>
8 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Over the past few decades,earth scientist have developed the theory of plate tectonics.Why is this theory useful?
mrs_skeptik [129]

we know where earthquakes occur the most so we know where to not settle. This also helps explain the creation of the earth.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Suppose some codons mapped to two different amino acids? What would the effect be on your translation of coded messages? What wo
    12·1 answer
  • As a cell grows, the ________________ decreases and the cell must divide or die.
    9·2 answers
  • Fats, oils, phospholipids, steroids and waxes are all examples of ________ which are macromolecules made up almost entirely of h
    9·1 answer
  • At what temperature does water exist as a solid???
    8·1 answer
  • Areas with heavy freshwater runoff and low evaporation will have ________ average salinity.
    10·2 answers
  • Ecology involves the study of all of the following except for the interactions between
    8·1 answer
  • Is the x axis going side ways or up and down
    6·1 answer
  • How does heart rate change during and after an exercise is performed for two different periods of time?
    5·1 answer
  • Choose the statements below that are true.
    10·1 answer
  • 2 points
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!