The answer is insects.
fly=insect
flies fly.
Hope this helps!
-Payshence xoxo
Reflex action refers to the response to a stimulus, while reflex arch refers to the path taken by the reflex action.
<h3>What is the nervous system? </h3>
1. Low oxygen levels are detected by sensory receptors in the arteries.
2. An impulse is produced by sensory neurons.
3. Certain parts of the brain get an impulse from the central nervous system.
4. Motor neurons carry messages from the brain.
5. Isabel's respiration becomes more rapid.
Reflex actions are immediate, reflexive reactions to stimuli that limit bodily harm.
Therefore, it travels to the brain via the central nervous system and sends impulses via Isabel's motor neurons, which aid to speed up her breathing.
Learn more about neurons, here:
brainly.com/question/12040535
#SPJ1
Ok. so first, the answer is c. then a. then c again. then b. then finally, d. hope this helps!
Answer:
The roots suck up the water in the ground. Then transfer it to the plant.
Explanation:
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
