1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorC [24]
3 years ago
11

A client who develops heart failure has a serum potassium level of 2.3 meq/l (2.3 mmol/l). digoxin and potassium chloride are pr

escribed. what action should the nurse take?
Biology
1 answer:
Artemon [7]3 years ago
7 0
<span>Hold the dose of digoxin, administer the potassium chloride, and call the primary healthcare provider immediately.
</span>
You might be interested in
What is this an example of?
Assoli18 [71]

Answer:

I think it's an example of equilibrium

8 0
3 years ago
I need help with this please , I’ll mark you as a brainliest
Serjik [45]
If I eat candy then I will gain weight
If I shave my beard then it will grow back darker

With this you should be able to solve the rest :)
6 0
3 years ago
Help please !!!!! It’s a test
astra-53 [7]

Answer:

A question is never clear

5 0
3 years ago
Where would a mutation need to occur for it to be passed onto offspring
Mrrafil [7]

reproductive cells like eggs and sperm

6 0
3 years ago
Please help i dont know how to do this at all I need to do it within 1 hour will give brainliest.
slega [8]

Answer:

?

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Ascidians are sac-like marine organisms. Their larvae have well-developed brains and dorsal nerve cords. This suggests that asci
    8·1 answer
  • What occurs after cytokinesis is completed at the end of meiosis 1?
    6·1 answer
  • During blank pollen moves from the stamen to the pistil?
    14·1 answer
  • What part of the cell functions in lipid-processing and phospholipid manufacture?
    15·1 answer
  • An insect looks like a leaf, so it blends in with its surroundings and is hard for predators to see. The insect’s characteristic
    7·2 answers
  • A woman wants to become pregnant. Which of the following is the best thing she could do for her potential baby prior to becoming
    11·2 answers
  • Which feature of nuclear fission reactions allows these reactions to take place in a chain reaction?
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Name four cycles that help to recycle matter in the biosphere
    15·1 answer
  • 1. A piece of pure gold (Au) has a volume of 50 cmWhat is its mass?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!