Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
At convergent point of plate boundaries, sedimentary rock that is present at ocean floor is pushed down into mantle. Due to the continuous movement of rock into the mantle increase the crust the temperature. Thus after continuous rise of temperature, crust melts down and eventually rise to surface of earth in the form of volcanic eruption. and after cools down gives rise to formation of igneous rock.
Explanation:
Process of igneous rock is given below
At convergent point of plate boundaries, sedimentary rock that is present at ocean floor is pushed down into mantle. Due to the continuous movement of rock into the mantle increase the crust the temperature. Thus after continuous rise of temperature, crust melts down and eventually rise to surface of earth in the form of volcanic eruption. and after cools down gives rise to formation of igneous rock.
Answer:
-1/5
Explanation:
It is an established mathematical proof that the slope of line A perpendicular to another line B is the recoprovaknofokad
Hence the slope of B = the negative reciprocal of B
Given that ; lines s and t are perpendicular ;
Slope of S = 5 ;
The slope of T = - 1/5
<em>Answer:-</em>
<em>Working slowly over many years, ground water travels along small cracks. The water dissolves and carries away the solid rock gradually enlarging the cracks, eventually forming a cave. Ground water carries the dissolved minerals in solution. The minerals may then be deposited, for example, as stalagmites or stalactites.</em>
<em />
In Europe, countries like Britain, Germany and France had abundant natural resources such as coal, iron and water which are key to industry.
For example Britain, where the industrial revolution began, had a lot of resources including water ways, waterpower, coal and iron ore. They used rivers for inland transportation. The first power source they had was waterpower, but as they started to use the steam engine, they used coal instead.
Britain also made machines, tools and building with iron ore.
