1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
3 years ago
13

Which of these is heated by radiation? A. An ice cube melts while you hold it in your hand. B. Hot soup rises to the top of the

bowl, while cooler soup sinks to the bottom. C. Coastal temperatures are cooler than temperatures in inland areas. D. The sun's energy is transferred through the vacuum of space to Earth.
Biology
1 answer:
blondinia [14]3 years ago
5 0

Answer:

Answer is option D.

The sun's energy is transferred through the vacuum of space to Earth by radiation.

Explanation:

The three forms of heat transfer are conduction, convection and radiation. The process of heat transfer between two solid objects in contact with one another due to a temperature difference is known as conduction. An ice cube melts while you hold it in your hand, is an example of conduction. Here, the heat energy from the hand is transferred to the ice cube and the ice melts.

Convection is the heat transfer occurs in moving materials (liquid or gas) due to the temperature difference between two regions. Hot soup rises to the top of the bowl, while cooler soup sinks to the bottom is an example of convection. The hot soup is less dense than cold soup, so it rises to the top and the cold soup at the top sinks to the bottom.

Radiation is a form of heat transfer where the heat energy is transferred through electromagnetic waves like infrared, UV rays etc. The sun's energy is transferred through the vacuum of space to Earth by radiation. Heat energy is transferred through vacuum by infrared radiation emitted by the Sun. The Earth absorbs it and turns the energy into heat.

You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
PLEASE HELP ILL GIVE BRAINIEST
TEA [102]

Answer:

Decomposers (Figure below) get nutrients and energy by breaking down dead organisms and animal wastes. Through this process, decomposers release nutrients, such as carbon and nitrogen, back into the environment. These nutrients are recycled back into the ecosystem so that the producers can use them.

Explanation:

6 0
3 years ago
When listing the levels of organization in organisms from smallest to lost complex which level is just below organs in
hichkok12 [17]

This is the smallest to largest in the organization of organisms: atom- molecule-cell-tissue-organ-organ system-organism. Tissue is just below organs.

3 0
3 years ago
Read 2 more answers
Please help!
liraira [26]
The correct answer is b.
7 0
4 years ago
2. Many people believe that
gladu [14]

Answer:

A mutation is simply an error in the copying of DNA it generally does not have major effects. Mutations are changes in the DNA sequence.  

Tumors form by an uncontrolled error in a stage of mitosis that continue to generate cells that aren't correct and eventually lead to tumors.

Explanation:

4 0
3 years ago
Other questions:
  • The information encoded in DNA is used within a cell in a two-stage process. The two stages of this process are called A) replic
    5·1 answer
  • Which structural feature of a spermatozoon contains mitochondria arranged in a spiral around the microtubules?
    13·1 answer
  • ______ and ______ properties can be used to classify and identify matter.
    11·2 answers
  • What’s the definition of chemical energy
    14·1 answer
  • What kind of tide does the observer experience when he is between tidal bulges?
    14·1 answer
  • What does an urn-shape age pyramid represent???
    6·1 answer
  • Which of the following is correctly matched?
    6·1 answer
  • What is the activities of life that occur the cellular level​
    8·1 answer
  • Disinfection is important in killing any remaining bacteria or pathogens in the wastewater. True False
    12·1 answer
  • Ollowing a disturbance, the climate of an area will always lead to repopulation by the same animal, plant, fungus, and bacterial
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!