1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
netineya [11]
3 years ago
13

The action potential in a cardiac contractile cell causes

Biology
1 answer:
ehidna [41]3 years ago
4 0

Answer:

Opening of L-type calcium channels.

You might be interested in
What is the correct order of organization for populations from least to most complex
ahrayia [7]
Populations 
communities
ecosystem
biosphere

8 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Individuals who are considered fit, have:
Schach [20]

Answer:

c or d

Explanation:

it is most likely c because people who are fit have stronger/healthier genes that have less mutations.

8 0
3 years ago
2. The rain shadow effect is associated with --------?
Ratling [72]

Answer:

The rain shadow effect is associated with mountains.

Hope this helps!

8 0
3 years ago
Arteries usually carry oxygenated blood away from the heart. However, the pulmonary artery carries deoxygenated blood. If a defe
larisa [96]

Answer:

lungs and heart

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • In an animal,how is the dna from this organelle inherited
    11·2 answers
  • Which of the following is true about the usage of public land? a. All public land is managed by the Bureau of Land Management (B
    15·2 answers
  • After blood leaves the heart through the aorta, what happens? Check all that apply.
    9·2 answers
  • How are Metamorphic Rocks formed?
    10·1 answer
  • A paleontologist has recovered a bit of tissue from the 400-year-old preserved skin of an extinct dodo (a bird). To compare a sp
    8·1 answer
  • What type of cell needs to be mutated for an organism to pass mutation down to its offspring?
    5·1 answer
  • Is there a future treatment for thalassemia ?
    9·2 answers
  • Can someone with perfectly healthy ears be deaf?
    9·1 answer
  • The puppy on the left is pulling with 7 N of force, while the puppy on the right is pulling with 5 N of force. Which statement b
    14·1 answer
  • What process creates the carbohydrates in this ecosystem?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!