1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anika [276]
3 years ago
15

How do you think the amount of sugar molecules in a photosynthetic plant changes over the course of a sunny day? Explain your an

swer.
Biology
2 answers:
MArishka [77]3 years ago
8 0
I think they can help the plant with
It’s roots and how it grows proply
soldier1979 [14.2K]3 years ago
4 0

Answer:

Plants perform photosynthesis in the presence of sunlight. The products of photosynthesis are sugar and oxygen. This means that the amount of sugar molecules in the plant will increase over the course of a sunny day, as the plant carries on photosynthesis.

You might be interested in
If sunlight begins to warm a frozen lake, the atoms in the lake’s frozen water will begin to move faster. True False
Masteriza [31]
This statement is true, because the warmer the temperature, the faster the atoms move in a liquid
4 0
3 years ago
Read 2 more answers
Need help asap please
garik1379 [7]

Answer:

Emigration : The act of leaving one's own country to settle permanently in another; moving abroad.

Immigration: is the international movement of people to a destination country of which they are not natives or where they do not possess citizenship in order to settle as permanent residents or naturalized citizens.

Explanation:

3 0
3 years ago
An electromagnet is different from an iron magnet because ________________.
Tanzania [10]

Answer:

A

Explanation:

Electromagnet is an electrical component that when powered emits a magnetic field based on the amount of current provided. this is the same principal that runs induction motors

8 0
3 years ago
Why shouldn't we wake up a person who is sleepwalking ?
bogdanovich [222]
When you wake up a sleep walker, they will be startled, and can have an outburst.
3 0
3 years ago
Read 2 more answers
A specialization of the stomach that aids in grinding for animals that lack teeth is the ____.
Arte-miy333 [17]

Answer:

C. gizzrd

Explanation:

5 0
4 years ago
Other questions:
  • What must a single-celled organism do before it can reproduce​
    7·2 answers
  • Pieces of DNA that code for particular traits that can be inherited
    14·2 answers
  • Predict what would happen if a persons sweat glands didn’t produce sweat
    6·2 answers
  • The image shows an ant that has been infected by a fungus, with the sporangium of the fungus emerging from the ant’s head. What
    9·1 answer
  • 16. What are the substances that constitute the chromatin? What is the difference between chromatin and chromosome?
    14·1 answer
  • Scientists that are involved in the creation of human growth hormone most likely work in which field?
    7·2 answers
  • Genetic engineering occurs when scientists
    12·1 answer
  • PLZ HELP i don't know this one (can't find)
    13·1 answer
  • A ____ surface will absorb all colors.<br> A green surface will absorb all colors and reflect ____
    6·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!