1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nevsk [136]
3 years ago
14

Kuala Lumpur means "muddy confluence." The city is located at the confluence of the Klang and Gombak rivers.

Geography
1 answer:
vekshin13 years ago
8 0

Answer:

True

Explanation:

Kuala Lumpur is the largest city in Malaysia, also being its capital, cultural, administrative, and economic center. The city's population is around 1.73 million people, being one of the fastest growing cities in the region. In the last few decades Kuala Lumper has been modernized, and the city has become much better organized and much more beautiful. The name of the city is derived from its location. The city has been built on the confluence of the Klang River and Gombak River, and the name of the city literary means a muddy confluence in the local Malay language.

You might be interested in
6. Why does the north-east coast of Canada remain icebound during the winter
kow [346]

The North East coast of Canada remains icebound during winter

because of forcing of the air. As the North East coast of Canada is

located near to Northern poles and is nearer to sea hence the ports of

eastern coast of Canada freezes and the temperature in that area

becomes less than zero degree during the winter time.

Ocean currents are horizontal continuous flow of water from one place

to other . There are two types of ocean currents warm and cold flowing

along the coastline which will have an impact on climate. Thus these

waters are cold and tend to freeze up the ports early in winters.

Refer the given below link for more information on North East Coast

brainly.com/question/19040332?referrer=searchResults

4 0
1 year ago
What sort of fossils would be expected to be found in Antarctica from more recent times, after it had moved much closer to the S
andreyandreev [35.5K]

Answer:

<em>a</em><em>n</em><em>k</em><em>y</em><em>l</em><em>o</em><em>s</em><em>a</em><em>u</em><em>r</em><em>s</em><em>.</em>

Explanation:

<em>a</em><em>n</em><em>k</em><em>y</em><em>l</em><em>o</em><em>s</em><em>a</em><em>u</em><em>r</em><em>s</em><em> </em><em>(</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>a</em><em>r</em><em>m</em><em>o</em><em>u</em><em>r</em><em>e</em><em>d</em><em> </em><em>d</em><em>i</em><em>n</em><em>o</em><em>s</em><em>a</em><em>u</em><em>r</em><em>s</em><em> </em><em>)</em><em>,</em><em> </em><em>m</em><em>o</em><em>s</em><em>a</em><em>s</em><em>a</em><em>u</em><em>r</em><em>s</em><em> </em><em>a</em><em>n</em><em>d</em><em> </em><em>p</em><em>l</em><em>e</em><em>s</em><em>i</em><em>o</em><em>s</em><em>a</em><em>u</em><em>r</em><em>s</em><em> </em><em>(</em><em> </em><em>b</em><em>o</em><em>t</em><em>h</em><em> </em><em>m</em><em>a</em><em>r</em><em>i</em><em>n</em><em>e</em><em> </em><em>r</em><em>e</em><em>p</em><em>t</em><em>i</em><em>l</em><em>i</em><em>a</em><em>n</em><em> </em><em>g</em><em>r</em><em>o</em><em>u</em><em>p</em><em>s</em><em> </em><em>)</em><em>.</em><em> </em><em>S</em><em>e</em><em>y</em><em>m</em><em>o</em><em>u</em><em>r</em><em> </em><em>I</em><em>s</em><em>l</em><em>a</em><em>n</em><em>d</em><em> </em><em>j</em><em>u</em><em>s</em><em>t</em><em> </em><em>o</em><em>f</em><em>f</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>A</em><em>n</em><em>t</em><em>a</em><em>r</em><em>c</em><em>t</em><em>i</em><em>c</em><em> </em><em>P</em><em>e</em><em>n</em><em>i</em><em>n</em><em>s</em><em>u</em><em>l</em><em>a</em><em>,</em><em> </em><em>i</em><em>s</em><em> </em><em>o</em><em>n</em><em>e</em><em> </em><em>o</em><em>f</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>m</em><em>o</em><em>s</em><em>t</em><em> </em><em>i</em><em>m</em><em>p</em><em>o</em><em>r</em><em>t</em><em>a</em><em>n</em><em>t</em><em> </em><em>f</em><em>o</em><em>s</em><em>s</em><em>i</em><em>l</em><em> </em><em>s</em><em>i</em><em>t</em><em>e</em><em>s</em><em> </em><em>o</em><em>n</em><em> </em><em>E</em><em>a</em><em>r</em><em>t</em><em>h</em><em>.</em>

8 0
3 years ago
"the heat energy that powers tectonic activity" on the surface of earth originates deep in earth's core. how does this energy mo
ryzh [129]
<span>Energy produced in the center of the sun flows out through the sun's layers in different forms, including visible light. The sun's interior generally becomes cooler and less dense as you move away from the center. </span><span>Rising currents of hot gas in the convection zone carry energy toward the sun's surface.</span>
6 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Which of the following had the biggest impact on species growth and diversity? Select the best answer from the choices below.
ivolga24 [154]

Answer:

F. Both A and C

Explanation:

I got the question right when i picked this

4 0
3 years ago
Other questions:
  • Question 10 of 10 In which galaxy is the solar system located ? A. Milky Way B. Andromeda C. Nuclear Reset Selection
    10·1 answer
  • In what way did the reslists portray life
    15·1 answer
  • Do all multicellular orgnismas follow the same pattern of organizations
    11·1 answer
  • Describe the effects of natural climate change
    8·2 answers
  • What landform forms as a result of a transform boundary?
    10·2 answers
  • What are the pros and cons of accepting refugees?
    15·1 answer
  • How did governments and international organizations cut down on the number of opium farms?
    14·2 answers
  • Give 4 facts about the structure of the Earth.
    15·1 answer
  • How many moles are in 1.78 x 10 22 atoms of potassium?
    10·1 answer
  • The standard biological ratio at birth of 105 males to 100 females is NOT found Iin which 2 countries
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!